Transcript

atg9a-202

ID
ZDB-TSCRIPT-090929-17064
Name
atg9a-202
Previous Names
  • atg9a-002
  • zgc:158700-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036601 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036601|OTTDARG00000027274|ZDB-GENE-070209-65 atg9a|OTTDARP00000029361 DKEY-264E9.1-002 LG_none BX539326.8,CT963095.5 Danio rerio protein_coding KNOWN, 738 bp
CAAAAATGCTTCAAATGGAAAAACAAAAGAGAGCTGGGCA
TTTATAAAAGAAGGCGATTCATAAATCACTTCTCATCACA
TTCGAATGAGGACTGAATGTCGAAGCTTTGCTGTTTCATC
TATAGGAAGAGCAGAATTGGACCCACAACGTAACTCCTTT
TGCTTTCATATACCCTATGAAATGGCGGGAGGTACAAGGC
AGCAGCAGAAGGGATAGTGTGTGACAGAAGATTTAGGGTC
TCACAGCAGGATGGCCCACTTTGATACGGAGTACCAGCGC
CTGGAGGCGTCTTACAGTGACTCCCCTCCTGGAGAAGAGA
ATCTGCTGGTCCATGTTCCAGAGGGATCCAAATCTCCATG
GCACCACATCGAAAATCTGGACCTCTTCTTCCAGAGAGTC
TATAATCTACACCAAAAGAATGGATTTACCTGTATGCTGC
TGGGAGAAATATTTGAGCTTGTGCAACTGGTGTTCGTGGT
GGCATTCACAGTGTTCCTGGCTAACTGTGTGGACTATGAC
ATCCTCTTTGCCAACAAGTTTGTTAATCATACAGATTCCT
TGAAAGTTACTCTCCCCGATGCGTTTCTCCCAGTGGACGT
GTGCAGTGCTAGGATTCGTGACAGTGTTCCGGTCATCTTC
ATCCTCGTCATATCAGGAGTCTTTTGGCTCCATCGTCTTG
TCAAATTTATTTACAATATCTGTTGCTACTGGGAGATCAG
ATCATTTTACATCAATGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations