Transcript

atg9a-201

ID
ZDB-TSCRIPT-090929-17063
Name
atg9a-201
Previous Names
  • atg9a-001
  • zgc:158700-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036600 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036600|OTTDARG00000027274|ZDB-GENE-070209-65 atg9a|OTTDARP00000029360 DKEY-264E9.1-001 LG_none BX539326.8,CT963095.5 Danio rerio protein_coding KNOWN, 3116 bp
AAACGAAACCAAAAATGCTTCAAATGGAAAAACAAAAGAG
AGCTGGGCATTTATAAAAGAAGGCGATTCATAAATCACTT
CTCATCACATTCGAATGAGGAAGAGCAGAATTGGACCCAC
AACGTAACTCCTTTTGCTTTCATATACCCTATGAAATGGC
GGGAGGTACAAGGCAGCAGCAGAAGGGATAGTGTGTGACA
GAAGATTTAGGGTCTCACAGCAGGATGGCCCACTTTGATA
CGGAGTACCAGCGCCTGGAGGCGTCTTACAGTGACTCCCC
TCCTGGAGAAGAGAATCTGCTGGTCCATGTTCCAGAGGGA
TCCAAATCTCCATGGCACCACATCGAAAATCTGGACCTCT
TCTTCCAGAGAGTCTATAATCTACACCAAAAGAATGGATT
TACCTGTATGCTGCTGGGAGAAATATTTGAGCTTGTGCAA
CTGGTGTTCGTGGTGGCATTCACAGTGTTCCTGGCTAACT
GTGTGGACTATGACATCCTCTTTGCCAACAAGTTTGTTAA
TCATACAGATTCCTTGAAAGTTACTCTCCCCGATGCGTTT
CTCCCAGTGGACGTGTGCAGTGCTAGGATTCGTGACAGTG
TTCCGGTCATCTTCATCCTCGTCATATCAGGAGTCTTTTG
GCTCCATCGTCTTGTCAAATTTATTTACAATATCTGTTGC
TACTGGGAGATCAGATCATTTTACATCAATGCGCTAAAGA
TATCCATGGCGGATCTTCCTTACTTCACATGGCAAGAGGT
GCAGGCAAGGATAGTTGAGATACAGAAGGAGCATCAGATT
TGCATCCACAAAAAAGAGCTGTCAGAGCTTGACATCTACC
ACCGAATACTTCGTTTTAAAAATTACATGGTGGCGATGGT
CAACAAGTCTCTTCTACCAGTACGCTTTCGGTTGCCTGTG
TTGGGCGATACTGTTTTTTACACCCGTGGGCTCAAGTATA
ACTTTGAGTTGATTTTCTTCTGGGGCCCTGGATCTCTTTT
TGAAAACGAGTGGAGTTTGAAGAGCGAGTACAAACGTGGA
GGGAATCGCTTGGAGTTGGCCGACCGCCTGAGCTCGAGGA
TCTTGTGGATTGGAATTGCCAATCTTCTCTTATGTCCGGT
TATTCTGATTTGGCAGATTCTGTACGCATTTTTTAGCTAC
ACTGAGGTGATCAAGCGAGAGCCGGGAAGCCTTGGTGCTC
GATGTTGGTCATTGTATGGCCGTTTTTACCTCCGCCACTT
CAATGAACTAGATCACGAGCTCATGTCAAGACTCAGCAAG
GGCTACAAGGCCTCCTCGAAGTACATGAACTGCTTTATGT
CACCATTGCTGACAGTCGTGGCCAAGAATGTGGCGTTTTT
TGCCGGCTCCATTCTTGCCGTTTTGATTGCTTTGACTATT
TATGATGAAGATGTGTTGGCTGTGGAGCATGTGCTCAGCA
GTATCACTTTACTCGGAGTTTGCATCACAGTCTGCAGGTC
GTTTATCCCAGACAAACATATGGTGTTCTGTCCAGAGCAG
CTGCTTAAAGTGATCTTGGCACACATCCACTACATGCCTG
ATCATTGGCAGGGTAATGCCCACAGATATGAGACCAGAGA
CGAATTCGCTCAGCTTTTTCAGTACAAGGCTGTGTTTATA
CTCGAGGAGCTTTTGAGTCCTGTCATCACTCCTTTCATCC
TTATTTTTTGCTTGCGACGCAAGTCCTTGGAGATCATTGA
TTTTTTCCGAAACTTTACTGTGGATGTGGTCGGTGTGGGG
GATACTTGCTCTTTTGCACAGATGGATGTCCGCCAACATG
GTCATCCTGCGTGGATGTCTGCTGGGAAAACAGAGGCCTC
CATCTATCAGCAGGCAGAAGATGGGAAGACAGAACTGTCG
CTCATGCACTTTGCCATCACAAATCCACACTGGCAGCCGC
CTCGGGAAAGCACACATTTTATCAGCCTTCTGAAAGAGAA
GGTGCATCGTGATGCCGCTGTCGGACAGCAGGGAATCATA
GCAGAGAATGCAGGCTTTACCTCAACACATTCACTACACA
ATGATTCAGAGCCACGTAGTCTTATTGCTAATCTGCTGAT
GGGTCCCCCTTCCCTGGCTTCACTGCATCTGGGTCGAGAG
GGCTCCATCAATCATGTGTCTATTGGAGTGAGTGAGGGGG
CATCTGCCCTGCGATCCCTCTCTCCTGTCAGCACTAGTCT
CCACCTGCGGGGCAGCTACCCATCAGCCAGACTGCCACGA
TCTGACCATCCAGCTGTGGTGGCTGGACGAGGAATGGCAG
GCTCTGGCACTGATGCCCGCACCATCAGCTCTGGCAGTAG
TGCCTGGGAAGGCCAGCTAACCAGCATGATCCTCTCAGAA
TACGCCTCCACAGAGATGAGCATTCATGCTCTCTACATGC
ACGAGATGCATAAGCAGCAGTCGCGAGGTGAGCTGTCTCG
ACACACTTGGCACAGGCAGGAGAGCGACGAGAGCAGTGAG
AGCGTCAATGAAGACGTTGAAGCAGCCCGCAACTTCCCCC
GATCCAGCACTTTCCCCTGCACAACCACCTCACACCAGGA
GGGGGCAGCAGCACAACAGAGCGGCAGCCAGCGGCGACAA
GGCGGAACCTCAGATCCTTCTTCTGGAAGCTTCCGTGTCC
AGAGGACCCCACGTATGGCCATGGGGGGCTGGTCTGAGGA
GAACCAGACGAGCCGACATCATGATCCAGTGCCTGAGGAG
GGCTCTGAGGATGAGCTGCCACCACACATACATAAGGTGA
CTTAATATCATAAATGAAGTAGACGAGAGAGACTCACACC
ATCCGTTTACTTTGGGACACAGATCACAAAGGTTATATTT
ATTTACTCTTTGACAGAACTGAAGTTCAGCTGTTGGATGT
CACGGTGTGGCACTGTATCGAATTTTCAGAGCATCTTGCG
AACTGAAACTTTGAAGAACATCACAAAATGTACTCGTAGA
TCTTACTTATTAATGAAAACTGCAAAACTGGTTGTGTAAA
ATATTTCATTTAGAATAGGAAAGTCTATTTGAATTACCGG
AATAAACGGCGTTCCTTCAGTAAAGTGTTTAGTAGGGTTG
CATTAACCTTAACATTTCCGTTTGTCAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations