Transcript

wasa-002

ID
ZDB-TSCRIPT-090929-16737
Name
wasa-002
Previous Names
  • wasa-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036229 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036229|OTTDARG00000027072|ZDB-GENE-081104-419 wasa|no_translation DKEY-48J7.6-002 LG_ CR450776.5 Danio rerio protein_coding NOVEL, 492 bp
AGTCATCAGTAGTGCAGAGGAGATCTCTCAGTTTTCCCCT
GCCTTCGACTGTACGTTTTTAACGGTTTGTTTAGACGGCG
TATGAGGCCATGAGGCGAGCCGCGAAGGGGAAAGCTCAGG
AGTGTTCGGGCAGCTCTTTGCTCAGTATACAAGAGAATGA
GAAGCTGGAGGATCTGCTGGGCAGGAGGTGTGTGTCTCTG
TCCTCAGCGGTTGTGCAGTTGCTTATGGCTCTTCCGAGCG
ACCCGAATCGATGGACACCACAACAATCTGGAGTTGTTTG
TTTCGTCAAGGACAGTTCTCTGCGCTCCTTTTTCATCCGT
CTCTACGACATCAAGGTTTTGCATGTCATTTCGGTCTTAC
TGTAACGTAATGAATCAAGCAACTTCAAAAATAATCTTCT
ATTTTGGATTTAATACATACATAAAATATACATTAATACA
TACATAAAACAAACCATCTCAAAATAAGATTCAATTTACA
GTAGTCTTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations