Transcript

wasa-201

ID
ZDB-TSCRIPT-090929-16736
Name
wasa-201
Previous Names
  • wasa-001
  • ottdart00000036228
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036228 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036228|OTTDARG00000027072|ZDB-GENE-081104-419 wasa|OTTDARP00000029074 DKEY-48J7.6-001 LG_ CR450776.5 Danio rerio protein_coding NOVEL, 2345 bp
CAACAAGGCGAGAGAATGAAAATAGAAAAAGAGAAAAAAA
AGTGTGGTTGTCCATTTCCTGTAAACCTTTTGTCTGCTAA
TGCTGAGAGTAAGAACTAGGAAGAGAAACTCAATGCTCGC
CGTTCAGCCTAGTCATCAGTAGTGCAGAGGAGATCTCTCA
GTTTTCCCCTGCCTTCGACTGTACGTTTTTAACGGTTTGT
TTAGACGGCGTATGAGGCCATGAGGCGAGCCGCGAAGGGG
AAAGCTCAGGAGTGTTCGGGCAGCTCTTTGCTCAGTATAC
AAGAGAATGAGAAGCTGGAGGATCTGCTGGGCAGGAGGTG
TGTGTCTCTGTCCTCAGCGGTTGTGCAGTTGCTTATGGCT
CTTCCGAGCGACCCGAATCGATGGACACCACAACAATCTG
GAGTTGTTTGTTTCGTCAAGGACAGTTCTCTGCGCTCCTT
TTTCATCCGTCTCTACGACATCAAGGCAGGGAAGCTGGTG
TGGGAACAGGAAATCTATAACCAGTTGATGTACCAAAAGA
CTAAACCCTTTTTCCACACTTTCCCTGGAGATGACTGTCA
AGTGGGTTTAAACTTTGCAGATGTAATAGAGGCTGAAAAT
TTCTTTGCTGTAGTGGAGGACAAGATCATGCAGAGAAATA
ATCGCTTCGCGGAGAAACAGCAGAGAAAAGGATCAGAAAC
AAGAGATCGTGGAGCATTGCCACCACTTCCTCCACCAAAT
GCGGTACCAAGTAATGTGCAGAACCAAATCATCCCAACCA
AATCAAAGAAAGAAAAGAAAGAAAAAGAAAAGAAAAGTAA
AAACAAAAAAGGATCAAAACTGTTAAAGGGTGATATTGGA
GCACCAAGTGGGTTTACGCATGTCAGTCATCTTGGCATGG
CTGGCAATAGCATAGACCCAGACGTGAAGAAACTTCTGTC
CTGCGCTGGGATCAGTGAAGCAGCTATGGAAGATTCAGAA
ACCTCTCAACTCATCTATGATGTCATCGAGCGTTCAGGTG
GAATGGAGGCTCTTAAAAAGGAAATGAGCCAGCAGGAGTC
TTCTCGCCCTCCTGTTCCAAGTGGACATCGAGGCTCCCTT
CCTCAAGTTCCATCCGGGTCAGCACCACCACCTTTGCCAC
AAGGTAGAATGGGGCCTCTACCACCTGTCCCAGGTCAGGG
TTCTGCTCCACCTTCCCAAAGAGGCTCCCTTCCACCCACA
CCTCCAAGAGCAGCGGGATCAGCACCACCCCCTGGTGGAC
TTCTGCCAGCCCGCTCTGCATCATTAGGGCCCCTACCAAA
TGTTCCTCCCGGAGGGCGTACTGGGCCTTTGCCTCAACCT
CCAGGACCTCGAAGTGGACCCTTACCACCTCCACCTACGA
ATCGAAGTGGAGGCTTGCCACCACCACTCCCAGGTGAACG
TAGGGAGTCTTTAGCCCCGCTTCCAGGAAAGAGACCTGGG
GCACAAGGGTCCGAAAGGCGAGGTAATTCCCTGCCGCCAC
AACCTGCTCAGACTCGACCACCACTACCTCCAGGAGCAAG
AAGTTCCCCCTTACCTCCACCTCAGAGAGACAATAGTGAA
TTCTTACCACCTCCACTGGAATCTGAAATGCCTCCTCCAC
CTTCTGATTTCTTCCCTCCTCCACCTTGTGATTCGTTTCT
CCCCCCTCCTCCTGACGACTTTGTTAATTCTATGCCTCCA
CCTCATCCCTCTCAATCCAACTTTCCTTCCCGAAACATTT
CCTCTGGCTACGCACCTCCACCCCCACCAATCTCCTCCAA
ACCCAGTGGAGGCGGCCCACCACCTCCACCTCCTCCTCCC
GCAGCTCCTCCTCCACCACCAGCTGCTCCTCCTCCAATGA
ACTTTGGAAGCAGTCCCTCTTCTGCAGCTGCTCCTCCAGC
ATCCAGCGGTGAGGAAGGAGGAAGAGGAGCATTACTAGCC
CAGATCCAAACAGGAATGAAGCTGAAAAAGGTTACTGCCA
GCCAAGAACCGCCTTCACCTGCTCAAGATTCAGGAGAGGG
AATAGTTGGAGCTCTCATGATGGTGATGCAGAAAAGGAGT
AAAGTCATCCATTCATCCGATGAGGATGATGAATTCGACG
ATGAAGACGATGATGATGAAGAGTGGGATTAATTGTGATC
TTATTGAATTTTTCTTCCAAGTGTGTCAGTAGGTTTGTTT
TGGAAATAAACAACACTGATTCAGTGAGTGTTTTCTCAGG
AGATGAAAATGCAAATTCAATGCATTTTTCTCTAGGCACC
TTCACCGATATTCCACTTTAGATCGATGAAGTACAGAAAA
ATTATACTATTATTTAAATAATAATATACAACAAAGCCAA
AAACAAAATGCAAACAAACAAATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations