Transcript

zic2b-002

ID
ZDB-TSCRIPT-090929-16730
Name
zic2b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036222 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036222|OTTDARG00000027069|ZDB-GENE-030219-92 zic2b|no_translation zic2b-002 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 693 bp
GGAGACCAGAGTTTTATAGCTTTTCGTAATGGGTCTGGAC
TATATTCTACACCTGACAAAACCTCAACCAGCTTTGAGAG
AAAGATGTATCCTGCCAGAAACGAAACACAGATTCTTCTC
TCGTAAACGCATAAAACTGGGCGGAGCACCAAGAGCCGTC
AGCACTGATTACTCACGGAGAAAAACCGTTCCTGTGTGAA
TTCGAAGGCTGCGACAGACGCTTCGCCAACAGCAGTGACC
GGAAGAAGCACATGCACGTTCACACGTCTGACAAGCCATA
TCTGTGCAAACTCTGCGACAAGTCCTACACACACCCCAGC
TCCTTGAGAAAACACATGAAGGTTCACGAGGATCAGGCTC
CAATAGCGGACTCCTCTCCTGCTGGAAGCTCCGGGTACGA
GTCCTCCACTCCGTCCAGTCTGATCTCTCCATGCTCGGAG
ACGCACAGCACCTTGTCGCCTGATTCTGCCGCGCTCAACA
GCAGCGGGCACAATAGCTTAACGTCCAATTTTAACGAGTG
GTACGTTTAAGGACTCCGCCAAGAACTGCATATCCTAAAA
TAAAATATTATTTGTAAATAGCAAATGAGGGTTTATGTTC
TCAGCATGTCGGTGTTGCACTGTGAATAAAGAAAGCCGAG
AATTATTATGTGTCTAAAAATGCAGGCAGTTTTCTTCAAT
GAACAACATGTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations