Transcript

zic2b-201

ID
ZDB-TSCRIPT-090929-16729
Name
zic2b-201
Previous Names
  • zic2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036221 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036221|OTTDARG00000027069|ZDB-GENE-030219-92 zic2b|OTTDARP00000029069 zic2b-001 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 2248 bp
TTGGATACACGACGCACAGAGAACCTGCGCAACCGCTACT
AAATCCAATTTGGCTCACCAATCGTACAGATGTACACATT
TCGTACGTTTTCAAAGCTTTTCCATCGCATAAAAAGGATT
TATTTGATTTGACTCAGTTCATCACGTGGCATGAGTTTTA
ATTAACCTAATTACGGGCAAGTAACAGCCACTCAGTTGCT
CATAGCCATATAGCTACTTTTTTTCTATTTAAACGCGGGT
GTAGTGTCTTTACGCATTCTTTGGTCAAAAATCGTGGTGA
TGTTACTGGACGCCGGCCACCAGATTTCTGGTTTAGGGGT
TGGCACGTTCACAAGGCATCACTCGGCTGTGAGCGAGACC
CAGGACAGAGATATGAGTTTTATGGAATCGGCGCACATGG
GCGCGTTCAAACTGAACCACCCCGATTTGTCCCCAGGCCA
GAGCGCAGCTTTTGCGCCACAAGCAAGCAGCTATTCTGCG
GCCGCTCTTGGAGCGCATGCGGCGGCGCACGCTGCCTCTT
TCGCCAGCTCCACTTTTAACTCCACCAGGGAGTTCCTCTT
GCGCAGCCGAGGATTTGGGGATTCGACTCCGGCCAGTGGA
CAACACCCCATCTTCAGCTCCACATCAGGGTCTCTCCATC
ACTCTCACCCAGAAGGTCAGGGTCACCTACTTTTCCCCGG
AATCCACGAGCAGCACGGGTCCCATCACGGCTCTCCAAAC
ATCCTGAATGGACGCCTTGGATTACCCGGTGAGGTTTTCG
GGCGGACGGAGCAGTATCACCAGGTGCCCAATACGCGGGC
CGATCCATACAGCCAATATGGCCTAAACATGAGTATGAAC
ATGGCGCACCATCCAGGCGCGTTCTTCCGCTACATGCGAC
AACAGTGCATCAAACAAGAGCTTATTTGTAAGTGGATCGA
CCCCGAGCAGCTCGGTGACCCCAAAAAATGCTGCAGCAAA
ACTTTCAGCACCATGCACGAACTGGTCACGCATGTGTCCA
CTGAGCACGTTGGCGGGCCAGAACAGTGTAACCACATCTG
CTTTTGGGAAGAATGTCCACGGGAGAGCAAACCATTCAAA
GCAAAGTACAAATTAGTGAATCATATCCGAGTGCACACGG
GAGAGAAACCCTTCGCGTGCCCATTCCCGGGATGTGGCAA
GGTGTTCGCGCGTTCGGAGAATTTGAAAATACACAAACGG
ACACACACTGGAGAAAAACCGTTCCTGTGTGAATTCGAAG
GCTGCGACAGACGCTTCGCCAACAGCAGTGACCGGAAGAA
GCACATGCACGTTCACACGTCTGACAAGCCATATCTGTGC
AAACTCTGCGACAAGTCCTACACACACCCCAGCTCCTTGA
GAAAACACATGAAGGTTCACGAGGATCAGGCTCCAATAGC
GGACTCCTCTCCTGCTGGAAGCTCCGGGTACGAGTCCTCC
ACTCCGTCCAGTCTGATCTCTCCATGCTCGGAGACGCACA
GCACCTTGTCGCCTGATTCTGCCGCGCTCAACAGCAGCGG
GCACAATAGCTTAACGTCCAATTTTAACGAGTGGTACGTT
TAAGGACTCCGCCAAGAACTGCATATCCTAAAATAAAATA
TTATTTGTAAATAGCAAATGAGGGTTTATGTTCTCAGCAT
GTCGGTGTTGCACTGTGAATAAAGAAAGCCGAGAATTATT
ATGTGTCTAAAAATGCAGGCAGTTTTCTTCAATGAACAAC
ATGTCCTTTGGTAGCTAATGCGTTGCCAAAGACAAAGAGT
GGATGTATTTTTAATTTTGGTCTGTATTAATTGTTTTACA
GTAACGTCGGGTCAAGTTACGATGTTTGAATAGCCTACAA
TGTATCTGTCATAGATTAAAGCTATTTGACGTTTCATGAT
TGTCTTACCATGAAAGTATTTTCGGGGATCCTTAAGTGCC
CAAGTCAAATGTTGTACAGTGAAAATGGACACAATTTCGT
GAATGTATTTTATTGTACGAATAATTATTTGTTACTCATG
TAGAAATCATCCACTTCGAGTTAGAGTATTTAGAAATGTC
TCGTTTTTAAATTATGGTATAGCTTATACTTGATAAAATA
CAAAATATTTATGGAAAAACTCGACGAAAATGTGTACAGA
ATTGTTACATTTAAAGTGTTTGTACATTGTTATTCAGTTT
AATGATGTAAATTCTTGTGATAACAAATGCCAAACATTAA
AATGAAGGAAAATATTATATAAAGGCAATAAAATGAAACA
AATCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations