ZFIN ID: ZDB-TSCRIPT-090929-15549
Transcript Name: fam208b-203
Previous Names: ch211-204d2.6-001, ottdart00000034850, si:ch211-204d2.5-002, si:ch211-204d2.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034850 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034850|OTTDARG00000032532|ZDB-GENE-041111-225 fam208b|OTTDARP00000028053 CH211-204D2.5-002 LG_ CR847826.13 Danio rerio protein_coding NOVEL, 994 bp
GCAAGATGGACGCAAACTTCTGACTTTCTGTTTCTTTTTC
GTTTCGTTTTGACTCGCGCGAGCTTCTCTCCTGGAAACCG
AAGGCAGTAGAAAGCGCGCGCTGTCGAGTGAATCCGAATC
CCGGTTAGAATTTCAATTCGGTTTCAAACGACCGTTTATT
TCAAACCGACTCGCTGGCAGCCGTTCGTTTTCACAGCCCA
GCCTTTGCTGTCTTTATGCGGATTCGCTTCCTGGTTGCAA
CACAGTCACATAGTACAATTCAAGTCCTCCAAAACGCAGT
TCAACCCGAGAGACCAGTCGTAGACAAATATAATTCTCTT
TAGAGCTTCCAGCGAACACTTCACCAAGAATTAACTGAAA
ATATACTATCGTTTTATTCGGTCAGCAGGAATGTCGTGAA
CCGCCGAGGATTAGAAATATCTAAAATATCGAGTGCAAAG
CGAGAACCTGTGATCTATGCCTCGTCTTCATGGAGAATGA
GACTAAACGACCAACAGAAGGTCTCCTGGAGCCTGTTCAA
CTAGGCTCAGTAACCTTTACCGAAAGTATTCTAGCTCCGC
TTCATAACAACTATTTGTATAAAGAATCAAAAGAATTTTT
TACATACAACTCAGCCCATTTGATCAACAATCCTGCTTCA
CAACAACGGTATGCTGCATTTCGCTCTGAGAAACGAGAAA
AAGGATACTCTGAACAGGAACTTGAAGAGTCATTTGGCTT
CCTGTTACTTGATGATATTAACAGGGCAAGGAAAGTTGGT
GAAACAGGCTTGTTGGTTGGGCGAGCGAAATGCTCCACCC
TTGGAGACTCCTTGAAAGGTGTCTACATTTCAAAATACTC
TGACTGCCTTGACCTGAAGCGGTGGTATGATGGCAAGACT
GGCTACATAGTGCTTTTGAAGCTCACCAAGGGCAAAGTGA
AAGAGGTCAAAGACAACTACACCCAGAATTTCACTCCTCC
AACACCTGGCTTTGACTGCCATGTATCAGAGCAG

tasor2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fam208b-202 (1)    Ensembl 10810
fam208b-203 10874
ncRNA ottdart00000034851 (1)    Ensembl 860
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam208b-203 Contained in:
[BAC] CH211-204D2 (1)

Genome Resources: Vega_Trans:OTTDART00000034850 (1),  Ensembl_Trans:ENSDART00000174039 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)