ZFIN ID: ZDB-TSCRIPT-090929-15548
Transcript Name: fam208b-202
Previous Names: ch211-204d2.5-001, ottdart00000034849, si:ch211-204d2.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034849 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034849|OTTDARG00000032532|ZDB-GENE-041111-225 fam208b|OTTDARP00000028052 CH211-204D2.5-001 LG_ CR847826.13 Danio rerio protein_coding NOVEL, 4280 bp
GCAAAGAGATGTTTCATCAGATGAGACCGGAGCTGAAGAG
CATAATGAGACTGCTAGTGCAAGGGAAGATCTTAAGCTTG
TGCATGAGCAGAATGATCACACAAATACGGATGATGACCT
GAAAGATGCCTCAACACATAAGATTACTGTTGAAGAGCAT
AAGGAAACTTCTAATGCGAATGGAGATCTGAAAGACGGTT
CAACACATGAGATTATCATTGAAGAGCATAAGAAAACTTC
TAATGCAAAGGAAGATCTTAAACCTTTGCATAATCTGAAA
GATCCCACTACTGCGATTGATGAGCTGAAAGATGCTTCAT
CAGATGGGACTAATGATAATAATATTTCTAATGACCAAGA
ATATCTTGTTCTGAAAGTTCAGTCAAATGCAGTTAACACA
TCATCTCATGTGCTTGGCGAGAATGATACTGAAGAGCATG
TAGAAAAGAAAGAAGGTTATACAGGTGAGGAAATGATGCA
AGAAGATAAGATAAAGTCAAAGGAAAGGGCTAAACTGAAT
GGCAGTGATACTGAACATGAGACATTCACAGCAATGGGAG
AACATCCAGATGGGTTTATTTTGCATCTGAATGATGACAC
AAACAGTCTTGATATGGAATTCAGTAATGAGAATGATTGT
GATATGAGTAGCAATAATGATATGAAGATGCAAAAGAGTA
AAAAGCAACCTATGACACCAGAGGAGGCAAGCCTTGAATA
TAATATCCTTCAAGAATTTGCTAATGATTCATGCTCAGAT
GAGGATCAACCCATGCCTGTTCAAGGTAAACAAACCTCAG
ATTCTACTATTGATCCTTTTAGATTAATAAAAGACCAACA
TGATTTCAAAATCCTTGAGCAGAATTTAGTGGCCTCAAAT
GATGTTCTTGACACTTGTCAGTATGATTCAAAACAAACAA
GTGCTGTTGAAACCACTAAATTAGATCTTATTCTATCAGA
AACAGAGGACGAAGAGGAGGTAGGCCAACAAGATGTATCT
GAAGCCAGAAGGGAGGAGGATACACTTGTTGAGAAGATTG
AGACACAATCCATTCAGCGTTTGTCTCCCAAAATTGGTGT
ATCTCTCCCCAAAACAGTGACTGAATCTACTATTGAAATG
TTTGCTCCTCAAGATTCGAAGAATGACAAACCTTCAGAAT
TGGAGATAAACAGCATGTGCTCTACTCCTACTCAAGATGA
AATTCCTGAAATATGTTATCCAGAAGTAAACAAAGAGTTG
AGGGTAGAAGATCTGGACAGAAAACTGTGCTTTCCTGACA
AAACTGTAGCTCATCACAATGATGTGTTGCCACTTGAAAG
TCTTGAAAGCTCCCAAACTTGTGTTTCTACCCCTAAGCCA
TTTTCTGATCTGATGGGACATTATGAAGAAACCCATCATG
ATGAACCAAGGTGGAAGATGAGCAAATGCCCAGAAGCAGA
GGCCTTTAAAGATAAATCTGATTCAACTACTGAGGATTCG
TCCAGTGAGGACTCTTTCCAGTTAAGACACAAACTCTGTC
CCAACTACCATGAAAAAGATAACAAGAAATATGACTTCCG
ACAGGGTGCATCTCAAAATGATTCAGAACTATTTTATGGT
CATGATAACGTAGATGATTATTATGACTATTACCATGGAA
CTGATGAAGGTTTACAATGGTATGATTACCAAACAGAGGA
ACCAGTTGTTCATCCACGTGAAAGCGACTTTAGTGGTGAC
TATGAGCCACCCACTTGTTCACAGCAAATTGCATCTGAAA
GCGAGTATTTTTATAAGCACAAAAAGCGAGCAAGGAAGGA
GATGGATGAGTATTGTTGGGAGCCAAACTACAAAATCGAG
CCCAAATATCCAATAAAGGTTACTTGTACTACTGACTATG
CAAAAAAGAAAAAGTCTAGAAAGAGTGAATTTCGTCGACA
TTCTGAATGGGACGATGATGACACTTCCAATAGTTTTGTG
GACTACAGCATCAGAAAAACTTCAAGCTCTGAAACTCATC
GATCAGTGCCAAATAGAATCACCGTTAGTTCTCAACCATC
TTCCAGTAAGCAACAATTTGACTGGCGGGCGTATTTCAGA
AGGGAGGCAACTTCCAATCAGCTATTAGATGCATGTGAAA
GGGATAACAAATTTGATGTCCCACCCTCATCCATTGTCAC
CGTTTTAGATAGGAAAGGATACCGCGTAACATTCAGTAAC
TCTCCCACAGCCAAACCATCTTTTGCTGCCGTCAGTGGAA
GTAGTTCAAATAAAACTTTCGAAGACTCTTTTAATCGTTG
GCAAGAACAACAGAGTATGGCTGATGGGACCCGGTCTACG
GTTGATTGCGAGTACCTCATCTTCTCTGATCAAATGAATC
AGGTTCTTAAGGATAGTAAGAGCCCTATTATTTCCACACC
ACGTTGTCGGACAAATCCTGAATCGTGTGGCATGACTGTT
CAATTTTCAAATCTCAGTGAAAATGAAAGCACTGATGAAC
TTAAAGCACAACCTTTTCTTTCGGATTTTAAACTGAACGT
GGACTTGTCCGAAAGGAAAGGGATGAGGGAGTCTGTAAAA
ACCAGCAAACCACATTTCCAAAAACTGTTCTGTGGAAAAG
CCAATATCGAGGAGTTTGCAGGCATTTCTGAAATAACAGA
GCAATGTGCTGTTGCTTACAAGTCCAGGATGAAAGAAGTC
TGCAGTGGGAAGAATCTTCCACCTCCAACCAAGGCACTCA
AGAGGAAATACAATCGAGAGCGCACTGGCCAACATCCTCG
ATCTTCTGGTCGAATCAAGAAAGATGTTTTTGACAGTCCT
CAAGAGAATCTGAAGTCTGTTGTGAGGCAGGCATCCAAGA
AAAAATACAGATTCTATATTCATGGAACGTCAACAGATAC
TTTCTTTGAAGAAACCAAGAACCTGATGGAGAGTGAGGGC
CATATGCCAGTTGAGCCAGACAACTTCAACCTCGATGGTG
AGGATCAACCTCTTCTCATTATACTGAGGAATGAGGACAT
TGCAGAACACATATGTGAGGTCCCTCATTTACTGGAACTG
AAGAAATCGCCCAGTGTTCTATTTGCTGGCATCGACCGAC
CTGATGACGTGGTGAACTGCACTCACCAAGAGCTTTTTGC
TAAAGGAGGCTTTATAATGTGTGATGAACTGGCTCTTAAC
GCACTCACTCTAGATGACATGAAGAAACTTGTGGGCATCC
TGGAGGAGTTAGACAAGCAAGGCAAATGGAAATGGTTTCT
GCACTATAGGGACAGCCGCAGGCTTCGGGAAAGCGCAAGG
TCCAGTCCTGAGGCAAACAAGAAGCAACAGTTCATTGATT
TTTGTCAGAAAGCTGGCGTAATCGAGGTCTTGCCCTATCA
CGACTGTGATGTAATATCACGGGAACGACCGGACTACTTC
TTCTGTCTGACTCGTCTCCAGATTCAAAACGCCTCTGTAC
GGTTTCCAGTGTTCATTACAGAAACACCAAGTGAAGCTTT
TGGTACCAATGGGATTTTAAGCATGAACATTTACACATTC
ACACGCATCCTTTCAAATGATACCTGTTCTGTGTCATGAA
TTATGTTGTTGTTTTTTAATCAAATCACATTTCTTACCAT
TGGTAAGTACACTTTTGTTCAGAAAAAATAATTTATTGTT
TATCGTAAATATTTAACCATATATCTTCAACGCACATGTA
ATTTCTCACAATCGATAAGCTTTCCAGTGAGAGCTTTACT
GTTTGTAATAAACTAAAAGTGTAAATGTAGGTCATGGAAA
TATTTTAGAAAGTTTTAACCTAACTTAGCTTTTTATAGAT
GAAATTGACTGAAACTCTAATAAATGACCTGATTTAGTAT
TCATTGTTGTTCATCTTTCTGCTTTGTGAAAACATTCAGT
ATTGTTTTAGCTGTTGCATCCATTGTGTTGTTTATTTGTA
GAGTGTTTTCACATTGCATCTGTGTACAAACTTAAAACTT
CAAATTTATTGAGTCATTTGTGAGATATGACTGGAACTTC
TGTATAATTACTATACATTTGTTTCTCTAACAAGATTTAA
ATGCAGATAAAAGATCCTGATTTGTTATATTTCACAATAT
GATTATAAGTTCATTTGTTGGTCTGGTTTACACTATTTTG
TAAAAGTCTGTAATAGTTCCACACTGTGTTTGATATATTC
TGACTTGCTGCTGTTTAAAAAGAGTTAAGCATTACTGGAT
GGAAAAGAAATCACAACTACTATATACTTTCCTACAGTTT
ATATAAGATTTATTTTTACATAAATTAGACGAGACCATTA

tasor2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fam208b-202 10810
fam208b-203 (1)    Ensembl 10874
ncRNA ottdart00000034851 (1)    Ensembl 860
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam208b-202 Contained in:
[BAC] CH211-204D2 (1)

Genome Resources: Vega_Trans:OTTDART00000034849 (1),  Ensembl_Trans:ENSDART00000147817 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE690491 (1) 905 nt
GenBank:CT600058 (1) 771 nt
GenBank:EB914472 (1) 655 nt
GenBank:EB947731 (1) 627 nt
GenBank:AI601631 (1) 585 nt
GenBank:EB971606 (1) 577 nt
GenBank:EB894037 (1) 564 nt
GenBank:AA542667 (1) 443 nt
GenBank:CK682941 (1) 331 nt
GenBank:EB922596 (1) 266 nt
CITATIONS (2)