Transcript

oc90-203

ID
ZDB-TSCRIPT-090929-14280
Name
oc90-203
Previous Names
  • oc90-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033209 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033209|OTTDARG00000025244|ZDB-GENE-070912-300 oc90|OTTDARP00000026871 CH211-66B9.2-003 LG_ BX511268.5 Danio rerio protein_coding KNOWN, 630 bp
TTAAATGTTTTATACAACTGATGTATAAAACCCCATTTCC
CACTGACCGTGACCGTTAAAATACGTGTATATTTATGTCG
TACAGGTTGTCTGGGTGTGCGGTTGACCTGGCTGTACGCG
GTGTTTGAAGACCTGCGGTCAGTGCTAGAGTTTGCGGTCA
GTCTGCGGTGTGAGACTGGACTTTGTCCTGCAGACATCCA
GGATCACGGGCATTACTGCAGTAACGCAAACACGCGGGAC
CTCCAGCAGATACAGCCCGTAGACGCGCTCGACGGGTGTT
GTTTTACTCACTTGAGATGTTCACAAGAGCTAAAGGAGAG
AAACTGCAGTCGCAGGGCACCATCAAACAACAACTACACC
TGCAGCTACAACTCCAGCTGCGATATGTTGGATTTCTGTG
ATGAAGGATTCTGTCGGTGTGATCGAATGGTTATAGACTG
CATCAGCTTCAACCGTCCAATCACAAAACAGGACAGAGAT
AACCAGCTTATCACATCACAGACAGTTTCTCCCTTTGTGA
CGGATCTACTTGAAAATGACACCTACATTAGTGATGTGGT
CAATGTAACAGAAAGTGTGGATCTTCCCCTGTCAGACATC
GACATGGAGACCATGTTCTACGAAGTAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations