Transcript

oc90-201

ID
ZDB-TSCRIPT-090929-14278
Name
oc90-201
Previous Names
  • oc90-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033207 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033207|OTTDARG00000025244|ZDB-GENE-070912-300 oc90|OTTDARP00000026869 CH211-66B9.2-001 LG_ BX511268.5 Danio rerio protein_coding KNOWN, 3250 bp
ATTAGAAGACATTGTGAAGTAGAGTTTGGATGTGTGGATG
TCTGACCACTGAAAATCTTGATTCATTCACACTGTGCAAG
ACTCATTGTATGAAAACTGGATTGTACGACTGATTCTTTT
AAAGATGAGGATGCTGTATCTTATTTTCCTCTTCGTACTA
CAGAAAGTTCACAGCACTGCTGTTTTCTGCCCAGAAACAG
ATGACCTCAACTCTGACAAGCTTCTGATTGGTTGTCTGGG
TGTGCGGTTGACCTGGCTGTACGCGGTGTTTGAAGACCTG
CGGTCAGTGCTAGAGTTTGCGGTCAGTCTGCGGTGTGAGA
CTGGACTTTGTCCTGCAGACATCCAGGATCACGGGCATTA
CTGCAGTAACGCAAACACGCGGGACCTCCAGCAGATACAG
CCCGTAGACGCGCTCGACGGGTGTTGTTTTACTCACTTGA
GATGTTCACAAGAGCTAAAGGAGAGAAACTGCAGTCGCAG
GGCACCATCAAACAACAACTACACCTGCAGCTACAACTCC
AGCTGCGATATGTTGGATTTCTGTGATGAAGGATTCTGTC
GGTGTGATCGAATGGTTATAGACTGCATCAGCTTCAACCG
TCCAATCACAAAACAGGACAGAGATAACCAGCTTATCACA
TCACAGACAGTTTCTCCCTTTGTGACGGATCTACTTGAAA
ATGACACCTACATTAGTGATGTGGTCAATGTAACAGAAAG
TGTGGATCTTCCCCTGTCAGACATCGACATGGAGACCATG
TTCTACGAAGTAAATGGCACGCTGAATGAGACTATGAGCA
ACTTCACTAATGAGCTGGTGCCGGTCAACGACTCTCTGAG
CAGCAATTTCCAGAGCACAGAGTATCCAGGGATATATCAG
TCAGGTCGAGAGGAGGAGGAGAATGAAGCCGGGGAGAAAG
AGCTGGGCAGAAACCCAGACAGAGAAAGCACACTTGAAAG
AGAGGAAGAGCCAGTGGAATATGAGGATGGGCTCTCCAAT
GTTACTGCTGTGTTGACAACCGAAGAGCCTGCTGGAGACA
ATGTGGAAGCCCCTACTACCAACAATCCAGTGCAATGGAA
CAAACTGGACTGGACAAACAATGAGCCGACTGTTAGCATG
GCGCTAACAGAATCACAGAATGTCACAGACTTACCAGATA
AGAACACACCCCACATGACCCCGCCAACAACATATGTACA
AACTCACTCACAACCTGACCATCATCCATTTGACGAAGAT
GATTATGAGAGTGAAGAAGATAAACTTCAGTTATTCACAA
GCAACACTTTAAAACCTACTACACACACTTTTGAACATAC
TACACTCACACAAACGCACACTACAACTAATTACACACAT
GGCATCACTAAACCACATGTCGACACACATGTTATAACAG
AAGAAGAGAGTGAAGAATCAGGAGAGGAAGGAGAAAAGGA
AGTACAATCTACACAGAGCCCTTATATGGTTTTGATGACC
ACACCCACTAAATTAACAACCAATCAAAGCTCGCATCACA
AAACAACCTCGTCAGTGGTGACCAGTAAAAATACAGCAGC
TTCTGTGCAGTTTCCCTCTATGAAAGAAAGTGAGGAGAAA
TACATATCAGATGAAAGTAAGCCAGAGAGCAAGGAAGATG
AAGAGACAGAAAAAGAGAGGGATTTATTAGCAGACCCGCC
AAACAAGAGTCTAGAAAGCAGCACAGAACAAAACTACAAA
TTAAGCACAACAAAACCAACAACTCCAACTCAAAAAATGG
ACAAGGAAGAGAGTAAGGAAGATTTACAAAGTCATGAAGA
GGATGATAAATCAACCACAAGCCAAACCACCACCATCCCA
TATAGGGTGAGCCAGATTAGTCCGTTCAGTTGGGTCATTC
CAGCACCGATCCCTAAACCTGTGGTTCATAGTGTATCACC
AGCACCAACAGTGGTAAAACCAACTACGAACCACAAGAGC
ACAACTGTGGTTCCTCAAAAGCCCATCAGCACACGGACCA
CAACATCAGGACGAGCTACTGTTGAAACCATCAGTCATCC
TCAGAAACCTCCCCATCCAATCACTGATCGGTCACCCTCA
TTGACCACTACGGAACGGCAGGAGTCTGCTGAGGAAGAGG
AGGAGGAGGAGGAGGAAGAAAAAGAGCCCTCTGACAGCTC
TCAGGAATCTAAGAAAATTGAGTCTCTTCGGGTCCGGGGA
CGAGCGCTGCCGTTTTTTACTTTGTCTCTGTTGGAAGCAG
CTGGACTCACAGATTTGCAGCAGCAAAAAGACTCTGAGGA
GTGTAGCATGTCTTTCCTCCAGTACAGCGCATCTGGACGG
GTGTGGAGGGATATGTCTGCTCTAGGAGAAATGTTACACT
GTCTGACCGGACGATGCCCTCATGAGTATCAACACTACGG
TTGCTACTGTGGTCAGCAGGGGACAGGACAACCAGTGGAC
CGACTGGACCGGTGTTGTTTTCTGCAGCAGTGCTGTCTGG
AGCAGCTCAGTGTGTTTGGCTGCAGGACAAACAGAAAACT
CAACGCTCACATCAGCTGCCACAAAGCAAAACCTCAATGT
TTCGGAGTGAGTGTGTGTGACCGGCTGCAGTGTGTTTGTG
ATCGCTCCACTGCTGAATGCATGGCGGCGTCACACTTTAA
CAGCTCCGCCAGCTCCTCATGCTCCGGGCCCCGCCCACTG
TGTCTCCGCACGGCTCATTCGTCAGCACAGTCGACCAATC
AGGAGTCCAGCGAGGAGAGCGATGAAATAAGCCAATCACA
GCCTCAGATCAACACACAATCAGACACAGTTGACAGAAAA
CCCACACAAAGCAAACCACAACAGGACGTCAGAGAAGAAG
AGGAAGACGAAGAAGGAAAGGAGAAAGAGGAAGAAGAAGA
GGAGGAAAAGGAACAAGAGGAAGAAGAGGAGGAAAAGGAA
CAAGAGGAAGAAGAGGAGCAGTAGAAGGAGGTGTTTTTGT
CATTTTGCTATTTTCAGGCAGCTCTTGATGATGTTATACA
CATTTAATGAAAAGTTTAGTATTCAGTGAAGATCTGCTGG
TTTTTGACCTACTGAAAGACCTTTTATATTCGGCTGTTTA
ATTAAAGAATAAAGGCATTTATTGTTCAGATAAAATGATA
GAATGTTGATAAAATATGTTGATTTCTGTAAAGAGAAATG
TTGAATATATATTAGTAAATTGAACTTTTATGCTTTTACA
TTTTTATATTAATATTTCGGTTTTATTATCAGTAAATTTA
GTACCTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations