Transcript

oc90-202

ID
ZDB-TSCRIPT-090929-14279
Name
oc90-202
Previous Names
  • oc90-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033208 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033208|OTTDARG00000025244|ZDB-GENE-070912-300 oc90|OTTDARP00000026870 CH211-66B9.2-002 LG_ BX511268.5 Danio rerio protein_coding KNOWN, 574 bp
CAAATATCTTTTACCTTTTTATTTAGTGTACAAAATGCTA
AATTTATGAATGACCACAAAACCAGACAAAAGTGTAATTT
TTCTGTAACTGAGTAAATGTATACATCACATGAAAGGTGT
TGTTTTACTCACTTGAGATGTTCACAAGAGCTAAAGGAGA
GAAACTGCAGTCGCAGGGCACCATCAAACAACAACTACAC
CTGCAGCTACAACTCCAGCTGCGATATGTTGGATTTCTGT
GATGAAGGATTCTGTCGGTGTGATCGAATGGTTATAGACT
GCATCAGCTTCAACCGTCCAATCACAAAACAGGACAGAGA
TAACCAGCTTATCACATCACAGACAGTTTCTCCCTTTGTG
ACGGATCTACTTGAAAATGACACCTACATTAGTGATGTGG
TCAATGTAACAGAAAGTGTGGATCTTCCCCTGTCAGACAT
CGACATGGAGACCATGTTCTACGAAGTAAATGGCACGCTG
AATGAGACTATGAGCAACTTCACTAATGAGCTGGTGCCGG
TCAACGACTCTCTGAGCAGCAATTTCCAGAGCACAGAGTA
TCCAGGGATATATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations