Transcript

apaf1-003

ID
ZDB-TSCRIPT-090929-13325
Name
apaf1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031486 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031486|OTTDARG00000024044|ZDB-GENE-000616-4 apaf1|no_translation apaf1-003 LG_ CT025647.7 Danio rerio protein_coding KNOWN, 647 bp
TGTAGGAGTGTGACAGCAGGAGACTCTAGTTGAGCTGTAT
TCATTTGAGGTGCGAAAACAGCGTGCAAGTGTCAAAAACG
TAATGAGAGCAGCCCCCCATTGGAGGCGTCAACACAAAAG
GGGAATTTCGTGGAATATCTGTGCACGAGGAGCAAAAGAA
ACACCCCGAAATGAGATTTAGAGAGTGGAACGGTGGATGT
GTTGAACACGTGGTGGTTCATGCGGACTAAATATGTTCTT
CCTTTATTTGTGGAACCCTAACAAAAAGACGTCTCAGAAC
ACTATGTTTGGACACATGGAGCCGGTCAATCACTGCTGTT
TTTCTCCTAATGACCTTTACCTCGCCACTTCATCCAGTGA
TGGCAGCTTGAAGCTGTTTGAAGTGTCATCTGCGAACGAG
TGGAAATCAATTGATGTCGATAGTTTTTTTCCTGAGAGTG
ACGAAGAAATAAAGGCCATGGTGAAATGCAGCACTTGGTC
GGCTGACGGCTCACAAATCATCTGTGCTGCCAGAAACACA
GTGTTTGTGTTTGATGTGGAGACGTCAGACCTGCTGCTGG
AGCTGAAGACGAGTCGTCTGAGCACTATTCAGTTCTGTCA
TGCGTGTCCTAACAGCAGCCTGCTGGCCGTCGCTCTCTCG
CATTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations