Transcript

apaf1-201

ID
ZDB-TSCRIPT-090929-13323
Name
apaf1-201
Previous Names
  • apaf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031484 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031484|OTTDARG00000024044|ZDB-GENE-000616-4 apaf1|OTTDARP00000025563 apaf1-001 LG_ CT025647.7 Danio rerio protein_coding KNOWN, 4533 bp
ATTTGCTTTTCTCTTCGTGTCTCAGGAGCTTCACGCCCAA
ACTTTTTGTCGTGACCCTTTTCTCATTTATTATTTTGTAT
ATCGTGACACAGTGACATGACATTTCATGCATCCCGCTTC
GTTGCACTAAGTAAATCAAAATTAAGTGCAGTGTTTCTCA
GACGAGCACTGCGGCTTATGTGGAGATGGAGGAACGTGCC
CGCAGCCGCCTGCTGCGCTCCAAAGCCACTCTGGAGCAGG
ACATCAAAGCCTCCTACCTGATGGACCACATGATCAGCGA
TGGCGTTCTAACCAATGATGAGGAAGCAAAAGTGCTCAGC
AAGGCCACTAGAAAAGAGCAGGCCGTGGCTCTGCTTGAGA
CCCTGTTGAGGAAAGACAATCGTGCCTACATTTCCTTCTA
CAACGCCCTGATCAGGGAGAGTTATGGAGATCTGGCCAGT
CTCCTTCACAGTGATTTGCCTCTGCTCAGCCCTGAGGGAG
AGAAGAGCTTCGCTGATGGAGTCTCTCCCTCTGTCCAGGC
GATTCTGAGTGTAGGAGGTGTTCCTCAGAGACCTGTGGTG
TTCGTGAGTCGACCTCCACTGCTCAATCTGATCCGGGAGA
TGCTGTACCGGCTGCGGGACACACCGGGCTGGGTAACTGT
ATTTGGCATGGCTGGCTCAGGGAAGTCTGTGATGGCTGCC
GAGGTTGTTCGAGATCGTTCACTCATTAAGGAGTGTTTTC
CTGATGGTGTTCACTGGCTGTCTGTGGGTCAGTGTGAGCG
GGCAGACCTGTTGGTTAGGATGCAGTCTCTGTGCTTTCGT
TTGGAGCAGTGTCAAAGTTCAGACACCAGTCAGCGGCCAC
CCAGCACTGTGGAGGAGGCCAAAGAGCGCCTGCGCTTCCT
AATGCTCCGCAGATTCCCCAGGTCTCTGCTGATTCTGGAT
GATGTCTGGGACAGTTCTTCCCTCAGGTCTTTTGATATCC
AATGCAGAGTTCTTCTGACCACACGCAATCGAGCTCTGAC
TGATTCCGTCAGCGGTGTAAGGTATGAAGTGCCTGTAGAG
AACGGTCTGGATGAGGAAAAAGCCTTGGAAATTCTTGCTT
TGTACGTTAATGGGAAGATGCACAAACTCCCAGAACAGGC
CCGCAGCATTGTAAGCGAATGTAAAGGTTCTCCTCTGGTG
GTTTCTCTGATTGGAGCTCTGCTGAGGGAGTTCCCTGACC
GCTGGAGCTATTACCTGCGACAGTTGCAGCAGAAGCAGTT
CAAGCGCATTCGCAAGTCTTCATCCTATGACTATGAAGCA
CTGGACCAGGCCATGGACGCTAGCCTGCAGGTTCTGGAGG
CCGAACACCAAGAGCTGTACAGAGACCTGAGCGTCATGCA
GAAAGACATCAAAGTGCCTGCTAAGGTTCTGTCTGTTCTG
TGGGGTCTTGAGCTGGAGGAGGTAGAGGACGTCCTGCAGG
AGTTTGTCAATAAATCTCTGCTTTTTCGGGACTGTAATCA
GCGACCGTATCGATATTACCTTCATGATCTGCAGCTGGAT
TTCCTCGCTGAACAAAACCGTGATCAGATTGCTGAACTAC
ATAAAAAGATGGTTCGTCAGTATCAGAGGTTCTACAGTAA
ACGCCCACCTGACTCTGCAGATAAAGACTCGTTGTACTGG
TACCAGTTCATCCCGTATCACATGGCTAAAGCAGGACTGT
CGAAGGAGCTTTATTCATTGATGTTTTCCTTGGACTGGGT
CAAAGAGAAGGCTCGGATTATGGGATCTGCCCATCTCATC
AATGACTATGTGGAATATGGGGAAATACTAGATAAAGAGA
ATAGTGAAGTGCGAGTGCAGTTTCAGGAGTTCCTCTCTCT
GAATGGTCATCATCTGGAGCAGAGGCCGTTCCCTGATGTG
GTCCAGTTGGCTCTGTCTCAGCCCGATCGCTCAGAGGTTT
ACAGACAGGCACTGATGCAGGCGCAGAAACGGGCCAGCAG
AGGGCAGATCTACCTCAACTGGGTGAATAAAAATATTGAG
GAGGGTTTGTCTCGGCTAGTCATGCACCCTCACCAGGGGG
CTGTCTACTATGCCTGCTTCTCAAAAGACGGGAGTAAAAT
TGCCTCTTGTGGAGCCAGCAAGGCACTTCGGGTGTTTAAA
TCAACCTCTGGAGAGAAGCTTCTGGAGCTTCAGGCTCATG
AGGAAGATGTTTTATGCTGTGCCTTTTCCCCTGATGACCG
GCATATAGCAACATGTGCCAGTGACAAGAAGGTGAAGTTG
TGGAATGTTGAGCGAGGTGTTCTTATCAGAGAGTTTGAAG
TTGAACACGAGGAGCAGATCAACCACTGCCAGTTCACCAA
CACAGGCCGAAGAGTCCTGCTGGCCACCTGCTCAAATGAC
AAATTCACTAACACCAAGTTGTGGAACCCTAACAAAAAGA
CGTCTCAGAACACTATGTTTGGACACATGGAGCCGGTCAA
TCACTGCTGTTTTTCTCCTAATGACCTTTACCTCGCCACT
TCATCCAGTGATGGCAGCTTGAAGCTGTTTGAAGTGTCAT
CTGCGAACGAGTGGAAATCAATTGATGTCGATAGTTTTTT
TCCTGAGAGTGACGAAGAAATAAAGGCCATGGTGAAATGC
AGCACTTGGTCGGCTGACGGCTCACAAATCATCTGTGCTG
CCAGAAACACAGTGTTTGTGTTTGATGTGGAGACGTCAGA
CCTGCTGCTGGAGCTGAAGACGAGTCGTCTGAGCACTATT
CAGTTCTGTCATGCGTGTCCTAACAGCAGCCTGCTGGCCG
TCGCTCTCTCGCATTACACCGTAGAGCTGTGGAACTTCGA
AAGCAGTAAGAAGAAAGCCGAATGCAGTGGTCATCTGAGC
TGGGTTCACTGTGTGCAGTTTTCACCCGACGGCTCACTCC
TGCTGTCCTCCTCTGATGATCAGACTATCAGGTTGTGGGA
GACGGACCGGGTTCACACTTCTTCTGCTGTGGCTCTGAAG
AGGGACACTGATGTGCTGTTCTCTCACAGTGATGCTACGA
TCATCGCACCCGATAGCAGTAACAGATTACAGGTGCTGAG
TGGATCTACAGGTGCTGTCGTGCTTGAGAGCGAGGAGCTG
TCATCCAGGATCCGCTGTTCGTGCATCAGCAGAAACGCTG
CATTTGTGGCTCTGGGATCTGAGGACGGAACAGTACAGGT
GATTGAGGTTCCTTCTTCAAAGGCATCAGTGAAGCTTTCA
GGCCACACTAAGACTGTTCACCACTGCCAGTTCACTGACG
ACTGTGAAATCCTTATAACATCCTCAGAAGATTCCACTAT
CCGGGTGTGGAAGTGGAGGACCGGCGAGTGTATGGTGCTG
CAGGGTCATATGGAGCCGGTCAGGAAGTTTCACCTCTTGA
GCTCTTCATCTTCTCCTCGTCTGTTCTCATGGTCGTTTGA
TGGCACAGTTAAGGTCTGGGATTTGACCAGAGGGCAGATG
CTGCAAGACCTCGTGTGTCATGAGGGTGCCGTCCTGTCAT
GTGATGTGTCCTCTGATGGACGCCTCTTTGCCACCACCTC
AGCTAATAGGACTGCTAAGGTGTGGAGCAGTGCCTCATGG
AAAATGATATTTTTGTTGGAGGGACACAAGGATTGCGTTC
GTAGCTGCCGTTTTTCTTGGGACAACAAGAGACTTGCAAC
TGGCGATGACAATGGAGAAATCCGGCTGTGGAGCATGCTG
GATGGAGCTCTCCTGAAGATCTGTTCTCGGGACACTAAAG
ACTCGATGGACTCCTACCATGGCGGATGGGTGACTGATCT
GCACTTCTCTCCTGATAACAGGGTGCTCGTCTCTACTGGC
GGATACATCAAGTGGTGGAGCGTGGAGAGCGGAGAAGCCC
TGCAGACCTTCTACACGATGGGAGGCAATCTGAAGAAGAT
CCACGTGTCTCCTGACTTCAGCACCTTCATCACTGTGGAC
AGCATCGGCATCCTTTACATTTTAAAGAGACTTGAGGGAG
AGGGAACATGACCCAGGACGGGGTGAAAGGCTTGTTGAGC
AAGCAACTGTGACTTCAAATGAGGAAATGCAATGCTGGCA
GCAATCTGTGCTGAAATGTGAGATGTGTGCGTGTGCGTGT
GCGTGTGCGTGTTTGTGTGTGTGTTTGTGTGCGTGTCTGT
GTGCGTGTCTGTGTGTGTGTAATTGTATGTTTGGTTTATT
TTTAAATGTGGGTGAAATGTTTGGTGCCAATATGTAGACT
TTTGCTTTAACAGCTCAGACAACATGCCTCATATAGGACA
AAGTATTGTCCGAGGGATTTTGAGCGCACACGGTGGTGTT
TGCTGTGGGCCAGTACTTTTGAAGAAAAGCTTTAATGTGC
ATGTAACCGCAGAGCCCTGTCAATGAGTTGATTTGTGATG
GGTGCTTTTAAAGTATGTTTGTGATGCCTGATTCCATGAG
GAAGTGTGTGTGTGCGTGTACATGAGTTTGTTTGTATGAA
ATGTAAAGAAAATGATCAACACTGCATTGGTGAAATGTGT
CATGACTTGTGACTGTAAATGTGAAATGATGATGATTGAA
AAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations