Transcript

cxxc1b-002

ID
ZDB-TSCRIPT-090929-13088
Name
cxxc1b-002
Previous Names
  • cxxc1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031062 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031062|OTTDARG00000023783|ZDB-GENE-030728-4 cxxc1b|no_translation cxxc1-002 LG_ CT573282.6 Danio rerio protein_coding KNOWN, 497 bp
CCAGTGTGCTTGAATATTATTCCATAGTCACATAAAGTAA
TTATTTTAATCAGCACTGTAGAGCTCTAAGGGTGTCTCAC
AATATCACATTTGCAATCACTTGACTTCATACTGTGTCAA
TCTGTGCAGTCGCATCTATGAAATCCTCCCGCAGCGCATC
CAACAGTGGCAGCAAAGCCCTTGCATTGCGGAGGAGCAGG
GTAAAAAACAGCTGGAGCGCATCCGCCGAGAGCAGCAGGC
CGCACGTATGCGCCTGGCAGAGATGGAGCGCCGTTTCCAC
GAGCTGGAGGGCATCATTGCCAAAGCCAAGCAGCAGCTGG
TCCTTCAGGATGAGGACGTGAATGAAACAGACAGTGAGGA
CACAGACCTTCAGATCTTCTGTGTGTCCTGTAGTCACCCC
GTCAACCCCAAGGTGGCACTCAGGCATATGGAGAGATGTT
ATGCCAAGTATGAAAGCCAGACGTCTTTCGGTTCCATTTT
CCCAACTAGAATAGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations