Transcript

cxxc1b-201

ID
ZDB-TSCRIPT-090929-13087
Name
cxxc1b-201
Previous Names
  • cxxc1-001
  • cxxc1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031061 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031061|OTTDARG00000023783|ZDB-GENE-030728-4 cxxc1b|OTTDARP00000025273 cxxc1-001 LG_ CT573282.6 Danio rerio protein_coding KNOWN, 2020 bp
ATTAGCCTTCTGCGCACATACACAGCCGAAACGACGTTGT
TAGCTGTCTGCCCACGGTCAGAATATTTCTGTTTATAATA
CCGCTTCATTTCTATTTTTATGTGGGCATTTATTTCAGTT
ATTATAGTCGCAGCATTCACTATGCAGTGATATATTATAT
GAATTAATTGATAGTTCATCCGTTTGATCGGATCCTTTTG
AAGGCGGGGAGCAGCGATGGACAGCGAAATGTCTGATATG
GACCAGACTCCAGGTCTGGACAACAGTATGGAAAAAGGAG
AAAATGCTCCTCTTTACTGCATTTGTCGAAAATCAGACAT
CAACTGCTTCATGATTGGTTGTGACAACTGCAATGAGTGG
TTTCACGGTCACTGTATTAATGTGACGGAGAAGATGGCCA
AAGCTATAAGAGAGTGGTACTGTCAACAGTGTCGGGCAAG
GGATCCATCACTTTCAATACGATATCGAAAGAAGAACCGC
GATAAAGATGTTGAGCCCGAGAGGGTTGAGAAACGATCCA
GCACTCCAGAATACAAGATTGATAAGCGACGTGGGTCTAA
AGTGAAGCGCTCTGCCCGTATGTGTGGTGAATGTGAACCC
TGCACCAGGACAGAGGACTGTGGTCATTGCGACTTCTGTA
AAGACATGAAGAAATTTGGAGGCCCAAACAAGATTCGTCA
GAAGTGTCGTCTGAGGCAGTGTGTTGTTCGTGCTCGGAAA
ATGCTGCGTGTTCGGGATGAGGAGTTTTCGCTGCGTGAGA
GGAAAGACAATATAATGCACAGGAATAGACGATACTCAGA
TGATTATGATGAGAACGATATGGATCTATATGAGCACTAC
AAGGACAGAAATGCGTCATGGGGCAGTGAGGATGATGATG
GCCAACTATACAGTCCTGTTCCACGGAAGAAAGCTATAAA
AGTCAAGCACGTCAAGAGGAGAGACAAAAAATTTGACAAG
AAGAAAGAGTCCCGTCGCCACAAGCAGAAGCAGAAGCACC
GTGATCGTTTGCGACACAGTGATAGGACAGACGGCAGACA
CGGAGGAGACACGCAACAGTGCCTGGGGCCAAACTGCATT
GAGCCGGCACGGCCAAACTCAAAATACTGCTCTGAGGACT
GTGGCATGAAGCTGGCCGCCAATCGCATCTATGAAATCCT
CCCGCAGCGCATCCAACAGTGGCAGCAAAGCCCTTGCATT
GCGGAGGAGCAGGGTAAAAAACAGCTGGAGCGCATCCGCC
GAGAGCAGCAGGCCGCACGTATGCGCCTGGCAGAGATGGA
GCGCCGTTTCCACGAGCTGGAGGGCATCATTGCCAAAGCC
AAGCAGCAGCTGGTCCTTCAGGATGAGGACGTGAATGAAA
CAGACAGTGAGGACACAGACCTTCAGATCTTCTGTGTGTC
CTGTAGTCACCCCGTCAACCCCAAGGTGGCACTCAGGCAT
ATGGAGAGATGTTATGCCAAGTATGAAAGCCAGACGTCTT
TCGGTTCCATTTTCCCAACTAGAATAGAAGGGGCAACAAG
ACTTTTCTGTGACGTGTACAACCCTCAGAGTAAAACATAC
TGCAAGAGACTGCAAGTTTTATGTCCAGAACATTCCAGAG
ACCCAAAGGTCACATCAGATGAGGTGTGTGGATGTCCACT
AGTCCGTAACGTGTTTGATCCAACTGGAGATTACTGCAGG
GTCTCCAAACGCAAGTGCAACAAGCACTACTGCTGGGAGA
AGCTCAGGCGGGCCGAGGTGGACCTGGAGCGTGTCAGAGT
GTGGTATAAACTGGACGAGTTGTTTGAACAGGAACGCAAT
GTGAGGACGGCCATGACCAACAGAGCGGGACTGCTGGCCC
TCATGCTCCACCAGACCATCCAGCATGACCCGCTGACCAC
CGACCTCCGCAGCAGCAAAGACAGATAGCCATCTCAGTAA
TCAGTATTCACTTGAAAAAACCCTCCTGTTCATATTTGTA
TATTTTTCATATTGTATATTTTGTCACTTTGACCATTCAC
ATTAAACACCTTCATGTGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations