Transcript

gtse1-202

ID
ZDB-TSCRIPT-090929-11413
Name
gtse1-202
Previous Names
  • gtse1-003
  • zgc:110687-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028982 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028982|OTTDARG00000022498|ZDB-GENE-050522-493 gtse1|OTTDARP00000023698 CH211-59O9.3-003 LG_ CR385081.7 Danio rerio protein_coding KNOWN, 848 bp
GTGATTTTCGAAACCAGACCTCGAAATTTCAAATGTGGAA
ACAGATCGCTAGTGCCTGTGAATAGACAACACTGCTGCTA
ATAAATTAAACTCTAAACAAAGCTTTGGACAAAACCAGGA
CTTTGGCCTCCATTTGTTTTCCTGGCTGAAGATGGCATCA
CTTTCTCACAGTGATTTTGTTTCACTGGCTGAGGAGAAAT
TTGACTTTGACGTTTCGTTGTCACCTGGAAGCTCTAAAGG
AGATTATGAAGTTGAAGATGAGGTCTTCGTGGGTCCAGTC
AGTCATAAAGAGAAATGCATCTCTCATGGTGTCGAGACTC
ACATGAAGGACAATATAAGCAGTGGTCCATCTCTGGGAGA
AGAGCCCAGCTGGAGTCCACTTACTGGAGAAAAGTTTGAT
GAAATCTGCAAAGAAGCTCAACAACTCGCCAGCCACATAG
AGCAAACCATCACCGATTCTGCAGCCGAGAGCAGCGTTGT
GTCCTCCTGTCAAACTGAGACATTTGAAGATGATGCAGCA
ACTAAACTGAACCTGTTCAGCAAGCCAGCTGATATTCTGA
GTCCCATCAAAAGAGAGACCTTCCTAGTGCAGGACAGTCC
AATGAAGCAGCTTCCACCCGCCATTCAGAAGCGCATGATG
AAGACTAACGGGAAGGCTGGGTTTGGAAAGCCACGTCTCA
GTACATCCAGTCCAGTCAGGCCTGCTGTGACGCAACATAA
GTTGGCATCCAAAAGCAAAGTCCTTATGGCCAATAGTGGG
GTGTTACCCAGCAAACCCACCGGCCAGGGGAACTCACGGC
TTTCATGCAGTGCAAAACCATTACCAGCCAACAAAACTAG
GCTTCCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations