Transcript

gtse1-203

ID
ZDB-TSCRIPT-090929-11412
Name
gtse1-203
Previous Names
  • gtse1-002
  • zgc:110687-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028981 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028981|OTTDARG00000022498|ZDB-GENE-050522-493 gtse1|OTTDARP00000023697 CH211-59O9.3-002 LG_ CR385081.7 Danio rerio protein_coding KNOWN, 748 bp
CGTGATTTTCGAAACCAGACCTCGAAATTTCAAATGTGGA
AACAGATCGCTAGTGCCTGTGAATAGACAACACTGCTGCT
AATAAATTAAACTCTAAACAAAGCTTTGGACAAAACCAGG
ACTTTGGCCTCCATTTGTTTTCCTGGCTGAAGATGGCATC
ACTTTCTCACAGTGATTTTGTTTCACTGGCTGAGGAGAAA
TTTGACTTTGACGTTTCGTTGTCACCTGGAAGGTTTGTTT
TCATTGTTAACTCTAAAGGAGATTATGAAGTTGAAGATGA
GGTCTTCGTGGGTCCAGTCAGTCATAAAGAGAAATGCATC
TCTCATGGTGTCGAGACTCACATGAAGGACAATATAAGCA
GTGGTCCATCTCTGGGAGAAGAGCCCAGCTGGAGTCCACT
TACTGGAGAAAAGTTTGATGAAATCTGCAAAGAAGCTCAA
CAACTCGCCAGCCACATAGAGCAAACCATCACCGATTCTG
CAGCCGAGAGCAGCGTTGTGTCCTCCTGTCAAACTGAGAC
ATTTGAAGATGATGCAGCAACTAAACTGAACCTGTTCAGC
AAGCCAGCTGATATTCTGAGTCCCATCAAAAGAGAGACCT
TCCTAGTGCAGGACAGTCCAATGAAGCAGCTTCCACCCGC
CATTCAGAAGCGCATGATGAAGACTAACGGGAAGGCTGGG
TTTGGAAAGCCACGTCTCAGTACATCCAGTCCAGTCAGGC
CTGCTGTGACGCAACATAAGTTGGCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations