Transcript

gtse1-201

ID
ZDB-TSCRIPT-090929-11411
Name
gtse1-201
Previous Names
  • gtse1-001
  • zgc:110687-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028980 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028980|OTTDARG00000022498|ZDB-GENE-050522-493 gtse1|OTTDARP00000023696 CH211-59O9.3-001 LG_ CR385081.7 Danio rerio protein_coding KNOWN, 2568 bp
AGACCTCGAAATTTCAAATGTGGAAACAGATCGCTAGTGC
CTGTGAATAGACAACACTGCTGCTAATAAATTAAACTCTA
AACAAAGCTTTGGACAAAACGACTTTGGCCTCCATTTGTT
TTCCTGGCTGAAGATGGCATCACTTTCTCACAGTGATTTT
GTTTCACTGGCTGAGGAGAAATTTGACTTTGACGTTTCGT
TGTCACCTGGAAGCTCTAAAGGAGATTATGAAGTTGAAGA
TGAGGTCTTCGTGGGTCCAGTCAGTCATAAAGAGAAATGC
ATCTCTCATGGTGTCGAGACTCACATGAAGGACAATATAA
GCAGTGGTCCATCTCTGGGAGAAGAGCCCAGCTGGAGTCC
ACTTACTGGAGAAAAGTTTGATGAAATCTGCAAAGAAGCT
CAACAACTCGCCAGCCACATAGAGCAAACCATCACCGATT
CTGCAGCCGAGAGCAGCGTTGTGTCCTCCTGTCAAACTGA
GACATTTGAAGATGATGCAGCAACTAAACTGAACCTGTTC
AGCAAGCCAGCTGATATTCTGAGTCCCATCAAAAGAGAGA
CCTTCCTAGTGCAGGACAGTCCAATGAAGCAGCTTCCACC
CGCCATTCAGAAGCGCATGATGAAGACTAACGGGAAGGCT
GGGTTTGGAAAGCCACGTCTCAGTACATCCAGTCCAGTCA
GGCCTGCTGTGACGCAACATAAGTTGGCATCCAAAAGCAA
AGTCCTTATGGCCAATAGTGGGGTGTTACCCAGCAAACCC
ACCGGCCAGGGGAACTCACGGCTTTCATGCAGTGCAAAAC
CATTACCAGCCAACAAAACTAGGCTTCCTCCTCCAAGCAG
AGGTAATTTTGGTCTGAAGCGCAGCCCCAGCAGTAGAAAC
ACAAGTAGAGCTGGCTCCTCTGAAGACCTTCTCTCTGATA
ACACCAGCGTTGCTTCTGACGTCAGTGATTCCTCCTTAAA
CACTAGTTTGCCTGGGCGAAGCAGCATTCCGGCCAGAAAC
AAGACAGAGCTGCGAGCTCCATCTGCTCTTAAAGCTCCTT
CACTTCAGAACTCAAGGGTTGTGGACAGAAGGAGAAACAC
CTCGTCCTCTTCTTCATCTGTGTCCAGCATTAACTCCAGT
CTAACGGTCTCTCCGGGGAGCAAAGCCAAACTCAACTCCT
CTCTAAACTCCAGCACTAACAGCATCGGCACTCGTTCTCA
GAGCAGTGTCAGCATGTTACCGAGTTCTAGCCGCAAATCC
TCAGTTGTTGCCCGAAACCCAGACCCAGTCGTCAGCAGAC
GCACCTCCATAACTACACAGAGCAGAAGGACGTCTGAAAT
TATGCCCAGGCCTGTCAAAGCGACGCCCATGAAAAAGACA
GAGTCGTTGCCGCCTCAACAGCTCCAGACTCCAGCAAAGA
CATCCAGCATCCCTGCATCCGCTGCTAAAGTCGGAAGTGC
TTTTCGAGGAAACCCGAAACTGAGACTTTCAGTGGTGCCC
ACGCCGACAAACTACATGAAAGCAGTTCACAAGTCTGAAG
CTTCCACATCACCTGATGTCCCTCGTATCATGAAGCCAAA
GAAATTATTGACCGCATGCAGTGTTGACAGTATTCCTGAT
CATCTAGCGGCTCCTCCAGCAGGCCTCCTGACGCCCTCAG
CCCTGGCCAGTAAACTAAGGAGACCCTCAGCTCTTCCAAC
CCCAGTAAACCGCCGTGTGTCAGGCATTCCTGCTCTCACA
CCTAAAAGTGTGTCACGTCTGAGTAAACCTGTCCAGATCA
CACAGTGCTCATCCACTGCTGACGAAGTGCCCATTTGTTT
GAGCCCAGAAAACATGAAAGAGAGTGAGAAATCAGAATAC
AAGCAGCCCTCGGTGTCCATTGAGGAGACCTGTCCTCCTG
CTGACCTCCAGCCCTGCTCTCTGCTCTTTAATATGGAGGA
CGAGTCTGAAGGATCTCCTGCCTGTGAGCCAGCAGACATG
GAGCCTCCTCCAGAACCTCCATCACATCAACCAGAGCCTT
CATCGTGTGATCCAGAGCCTCCTTCTCCAGTCGACATCAA
GTCTCCAGCACCTCCAACCACAGCAGACATGCACAAACAG
CACCCGCAGAAGAACATGGAGAAAAAAGAGGTTTTGCTGG
TGGATGCGCCTGCACCAACACGTCAGCTGTCAGAAAAGCT
GCTCATTGATTTGTCCAATACACCAGACCTGATCAAAACC
TCCTCTGGAAAGCCGTGGGCGGGACAGTTAATTGACCTGA
GTTCACCTCTTATAAAGTGGAGTCCAGAGAACAAGAAAAG
ATCTGAAAATGTGGCGCCGCTGATCGACTTATCGTTTTAG
AGGACCTGCTGATTTTACTGTGAACTGTGTCTAGAAAAAA
ATTAATAACTGGAGCATTTCAAATGTGCTAACATGAACTT
AAAGAGGGAGAGCAGATGCTGCTGTTTTCGTTATTAACCT
TTTTTTTTGTTTGTTTTATTTGTGTTGTCTGTCTCATGTG
AATTTAATGTAATTATGGTAATTTGCTGAATTTTAAAAAT
GAAACTTGTATTTCCCCCCAGAAGGTACAAATAAATGTAT
TAAATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations