Transcript

zgc:77439-006

ID
ZDB-TSCRIPT-090929-10382
Name
zgc:77439-006
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027840 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027840|OTTDARG00000021772|ZDB-GENE-031010-24 zgc:77439|no_translation DKEYP-108B5.1-006 LG_ CR853281.6 Danio rerio protein_coding KNOWN, 767 bp
CGGAGTATTGAGTCTCGTCCGCTTTGAGAGACTGACGGAT
CCCGGTGCTGGTGGTCGTCCGAGGACAGCTGTAGAGACCA
GCTTCATATCCTACAGTGTCAACTTTCCGTTTCACACCCG
TAGTGTGCTGTACAATGCCTGGCGTAAGGAAGCTGCGTGT
GGCTGTTATCGGCGCCGGTGCTGCGGGACTCTGCGCTGCC
CGTCACCTGCTCTCCCGCCCGGACACCTTCGCGGCGCCGG
TGGTCTACGAGCTCACCAAGAACATCGGAGGAACCTGGGT
CTATGAGGAAAAAGTGGGACACTATGAAGATGGCTCACCG
ATTCACAGCAGCATGTACAGAGACCTCAGAACCAATATTC
CCAAAGAGGTGATGTCTTTCCCTGACTTTCCTTTTGCAAA
ACACCTCTCTTCTTTCGTCCATCACACCGAGGTACGAAAG
TACCTTGAGCAGTACTGTGATCATTTTCGCCTTCGGGACT
ACATACAATTTGGGACCTCAGTGGCCTCAGTGAACCCAGT
CTCTGTGAAGGATGGGTGGAATGGTTTGGCATGGAACGTC
ACCTCAAATAATGGCTTAGACCACAGCAAATCCACTACAG
AGCGCTTTGATGCTGTCATGGTGTGTAACGGGTAAGTGCT
CAGCAACAGGCAGAAAAGCTTCCTACATTGCACTATAGTT
AAAATGTACATGCCTGGATCAATAAGGACATCGGGTACAG
GAGATTAAACAGTAACTAATGATGCAATGAAACTATACTG
CACTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations