Transcript

zgc:77439-206

ID
ZDB-TSCRIPT-090929-10378
Name
zgc:77439-206
Previous Names
  • zgc:77439-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027836 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027836|OTTDARG00000021772|ZDB-GENE-031010-24 zgc:77439|OTTDARP00000022784 DKEYP-108B5.1-002 LG_ CR853281.6 Danio rerio protein_coding KNOWN, 815 bp
AAAGGTGTCACGTGACGCGCTCGATAAAACGGCTAAAAGT
GTAGGCCAGTGTCTGTTTTCTGGAGGTCCACAGAAGCTGC
CTCTTTCAGCCTCATTTTACGGTGTCAACTTTCCGTTTCA
CACCCGTAGTGTGCTGTACAATGCCTGGCGTAAGGAAGCT
GCGTGTGGCTGTTATCGGCGCCGGTGCTGCGGGACTCTGC
GCTGCCCGTCACCTGCTCTCCCGCCCGGACACCTTCGCGG
CGCCGGTGGTCTACGAGCTCACCAAGAACATCGGAGGAAC
CTGGGTCTATGAGGAAAAAGTGGGACACTATGAAGATGGC
TCACCGATTCACAGCAGCATGTACAGAGACCTCAGAACCA
ATATTCCCAAAGAGGTGATGTCTTTCCCTGACTTTCCTTT
TGCAAAACACCTCTCTTCTTTCGTCCATCACACCGAGGTA
CGAAAGTACCTTGAGCAGTACTGTGATCATTTTCGCCTTC
GGGACTACATACAATTTGGGACCTCAGTGGCCTCAGTGAA
CCCAGTCTCTGTGAAGGATGGGTGGAATGGTTTGGCATGG
AACGTCACCTCAAATAATGGCTTAGACCACAGCAAATCCA
CTACAGAGCGCTTTGATGCTGTCATGGTGTGTAACGGACA
TTTCTATGACCCTTACATCCCTGCAATACCTGGACTGGAG
AAATTCAAAGGGGCGCTGATACACAGTCATGATTACCGTA
GTGCTGAACCTTTGGCAGGAAAGTCAGTGGTGCTGCTGGG
AGCTGGTCTCTCCGGATTGGATATTGCCATGGAGCTCTCC
AACGTTAATGCCAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations