Transcript

zgc:77439-204

ID
ZDB-TSCRIPT-090929-10379
Name
zgc:77439-204
Previous Names
  • zgc:77439-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027837 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027837|OTTDARG00000021772|ZDB-GENE-031010-24 zgc:77439|OTTDARP00000022785 DKEYP-108B5.1-003 LG_ CR853281.6 Danio rerio protein_coding KNOWN, 773 bp
TGAGTCTCGTCCGCTTTGAGAGACTGACGGATCCCGGTGC
TGGTGGTCGTCCGAGGACAGCTGTAGAGACCAGCTTCATA
TCCTACATGTGCTGTACAATGCCTGGCGTAAGGAAGCTGC
GTGTGGCTGTTATCGGCGCCGGTGCTGCGGGACTCTGCGC
TGCCCGTCACCTGCTCTCCCGCCCGGACACCTTCGCGGCG
CCGGTGGTCTACGAGCTCACCAAGAACATCGGAGGAACCT
GGGTCTATGAGGAAAAAGTGGGACACTATGAAGATGGCTC
ACCGATTCACAGCAGCATGTACAGAGACCTCAGAACCAAT
ATTCCCAAAGAGGTGATGTCTTTCCCTGACTTTCCTTTTG
CAAAACACCTCTCTTCTTTCGTCCATCACACCGAGGTACG
AAAGTACCTTGAGCAGTACTGTGATCATTTTCGCCTTCGG
GACTACATACAATTTGGGACCTCAGTGGCCTCAGTGAACC
CAGTCTCTGTGAAGGATGGGTGGAATGGTTTGGCATGGAA
CGTCACCTCAAATAATGGCTTAGACCACAGCAAATCCACT
ACAGAGCGCTTTGATGCTGTCATGGTGTGTAACGGACATT
TCTATGACCCTTACATCCCTGCAATACCTGGACTGGAGAA
ATTCAAAGGGGCGCTGATACACAGTCATGATTACCGTAGT
GCTGAACCTTTGGCAGGAAAGTCAGTGGTGCTGCTGGGAG
CTGGTCTCTCCGGATTGGATATTGCCATGGAGCTCTCCAA
CGTTAATGCCAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations