Transcript

gbp1-003

ID
ZDB-TSCRIPT-090929-10142
Name
gbp1-003
Previous Names
  • zgc:92185-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027594 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027594|OTTDARG00000021630|ZDB-GENE-040718-32 gbp1|no_translation DKEY-97A13.3-003 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 775 bp
TGTGTTGAAGCAAGTTGGAGCTAAACTCAGCAGGACACCG
GCTTTCCAGGGCTGAGTTTGGACACCCCTGAGGTACATCA
TGCTAATTACAGAAATGTAATTGTCTCAGGCTTTGCTCTC
GGCAACACTATTGAGTCAAAGACCAAAGGTATCTGGATGT
GGTGTGTCCCTCACCCGAAAAAACAAGGACACACTTTGGT
TCTGCTGGACACAGAGGGACTGGGTGATGTTGACAAGGGA
GACTCTAAGAACGACGGCTGGATCTTCTGTTTGGCTGTTC
TTCTCAGCAGTACTCTGGTGTACAACAGCCGTGGCACCAT
CGACAACAGCGCACTGGAGAAACTGCACTACATCACTGAG
CTCACAGAGCAGATCAAGATCAGAACAGCAGAAGCAGCAG
ACGAGGAGGATGAGGAGGACTCAAAGTTTGTGCTTTTCTT
CCCATCATTCACCTGGGTCGTGAGAGATTTTACTTTGGAT
TTGGTGATTGATGGAAAGAATGTTAATGAAGACCAGTACC
TAGATTTTGCCCTGCAGCTGAGGAAAGGTAATAATAAGAA
GGCATTGGAATACAATCTGCCCCGTCAGTGCATTCGAAAC
TACTTCCCATCCCGGAAGTGTTTTGTGTTCCCATCTCCAG
CCTCACCTGAGAAGATGAAGCAATTAGAAAGTCTGCAAGA
AAAAGACCTTGTACCAGATTTTCTGGAGGTCACAGGTCGT
TTCTGTGAGCACATCTTTCGCAACAGTGTTGTGAAAACAC
TGAAAGGGGGGCATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations