Transcript

gbp1-201

ID
ZDB-TSCRIPT-090929-10140
Name
gbp1-201
Previous Names
  • gbp1-001
  • zgc:92185-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027592 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027592|OTTDARG00000021630|ZDB-GENE-040718-32 gbp1|OTTDARP00000022596 DKEY-97A13.3-001 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 2343 bp
AGAAATCGACTGTTTAAAGTAAGCTAAAGCTATTAGGGCA
GATATTGGCAACAATCGACCTCCATAAATAGGACCCGCAT
TTCCATTCATCCCGCAGTGAGAAAGAAGGACCGTGGAGGG
TAGGAGAGCTTCGGAAGGAAGAGCTAGAAAACAGACAGGA
AGTGCTAGAAAGAACCAACATGTCTAAACCCACAATGATG
CCTTCGCCCATTTGTTTGGTGGAGAATGTGAACGGATCAC
TCAGCATCTGTAAAGATGCCATAGATTTTCTCAGTAATAT
TAATGAGCCGGTGGTGGTGGTGTCTGTGGTGGGACTCTAC
CGTACGGGGAAGTCTTACCTCATGAACCGACTAGCTGGAC
AACAGACAGGCTTTGCTCTCGGCAACACTATTGAGTCAAA
GACCAAAGGTATCTGGATGTGGTGTGTCCCTCACCCGAAA
AAACAAGGACACACTTTGGTTCTGCTGGACACAGAGGGAC
TGGGTGATGTTGACAAGGGAGACTCTAAGAACGACGGCTG
GATCTTCTGTTTGGCTGTTCTTCTCAGCAGTACTCTGGTG
TACAACAGCCGTGGCACCATCGACAACAGCGCACTGGAGA
AACTGCACTACATCACTGAGCTCACAGAGCAGATCAAGAT
CAGAACAGCAGAAGCAGCAGACGAGGAGGATGAGGAGGAC
TCAAAGTTTGTGCTTTTCTTCCCATCATTCACCTGGGTCG
TGAGAGATTTTACTTTGGATTTGGTGATTGATGGAAAGAA
TGTTAATGAAGACCAGTACCTAGATTTTGCCCTGCAGCTG
AGGAAAGGTAATAATAAGAAGGCATTGGAATACAATCTGC
CCCGTCAGTGCATTCGAAACTACTTCCCATCCCGGAAGTG
TTTTGTGTTCCCATCTCCAGCCTCACCTGAGAAGATGAAG
CAATTAGAAAGTCTGCAAGAAAAAGACCTTGTACCAGATT
TTCTGGAGGTCACAGGTCGTTTCTGTGAGCACATCTTTCG
CAACAGTGTTGTGAAAACACTGAAAGGGGGGCATAAAGTC
ACTGGTAAATTGCTTGGACATCTGGCTAAGATTTACGTGG
ACACGATCAGCAGTGGTAAAGTGCCCTGTCTGGATAACGC
CGTGGTTGCTCTGGCAAATCTAGAGAACAAGTGTGCTGTT
GAAGAAGCTTTCAAAGTGTATGAGAGAGGGATGGAAGAGG
TGAAGAAGACATTTCCAGTAAATGTGGATGAAATCTCCTC
TGAACACCAGAGGTTTAGCAGTCTGGCCAACGCTGAGTTC
ATGAAACGCTCCTTTAAAGACGAAAAACAAGAATACATTA
ATCAACTGAAAGAAAAAATCGATGTGTACTATGGATGCCT
GCTTGAAGACAATGGCTTGGCATCAAAGAAAAAGTGTGAA
GATCTGCTGAAGGATCTGTTCTCTGAAATGAATAAAAAGT
TGCAGGATGGAGTGTACAGTCAGCCTGGTGGATATGAACT
CTACTGCAAAGACAGAGACGTCATCGTTGAAAAGTACCGC
AGAGAACCCAACAAAGGTGTACTGGCCGAGGCCGTGCTGC
ATGAGTTTCTGAACGAACGAGGAGCTGAAGCAAACAGCAT
CCTCTACACAGATACAAAACTCACTGAAAACGATAAAAAG
ATTCAAGAGGAGAAGGAGAGGAATGCTTTGATGCAACAGA
AGTGTGAGGAGGAACAGGAGAAACGAATAGAGAGCGAACG
AATGATGGCGGCAGAAAAAGTGCGGCAGGATGACCAAATC
AAGCAGATGCAGGAGAAGTTTGAGAAGGAACGAGAGCAAA
TGCAGCAGGAGACGGAGAAAGCCATCGACAGCAAACTAAA
GGAGCAGGAGGAGATGCTGAATAAAGGCTTTAAGGAGAGG
GCTGATCTCCTATCTGAGGAAATCAATGATCTGAAAAAAG
AGAAGAAAGGATTTATGGAAGAATACATCATGCCTATTGT
TGGAGCTGCGGCACAAATCCTTCCTACAATTCTTGATTAC
AGAGTGATGATGAAAGGAATGAAATATGGAAAAGTAAAAA
TATAATTAATGTTTACATTTAAATCCCTGTTGTGACCAAT
TGATTGGCTGTTGACTGTTTATACAGCTTACCAGATGTAA
TCATGTTTATTTAGGAGCATAGTATTTAGTTTGATAAAAA
GTGGTGTCCTAGATCACATAGGTGTGTACTGAAAGTATCT
GCTTTGTTTCTGATGATGGAAAAATCAATGATATTAAGAT
TATTTCATAGCCCTTAATTGCACCTTGATTGCACATTCTG
CCATATTATATGTATGGATTCAAGCATTATGTTCATTTTA
ATAAATTCATTAATAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations