TALEN

TALEN2-gdf9

ID
ZDB-TALEN-240220-1
Name
TALEN2-gdf9
Previous Names
None
Target
Target Sequence 1
5' - TAGTGCGCTTTGTTACC - 3'
Target Sequence 2
5' - TCCGAGAACTGCGAGGACAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo18 gdf9
Expression
Gene expression in Wild Types + TALEN2-gdf9
No data available
Phenotype
Phenotype resulting from TALEN2-gdf9
No data available
Phenotype of all Fish created by or utilizing TALEN2-gdf9
Phenotype Fish Conditions Figures
male germ-line sex determination disrupted, abnormal gdf9umo18/umo18 standard conditions Fig 4 with image from Chen et al., 2022
ovarian follicle stage III absent, abnormal gdf9umo18/umo18 standard conditions Fig 1 with imageFig 2 with image from Chen et al., 2022
ovarian follicle development disrupted, abnormal gdf9umo18/umo18 standard conditions Fig 1 with imageFig 2 with imageFig 6 with imageFig 7 with image from Chen et al., 2022
ovarian follicle stage IV absent, abnormal gdf9umo18/umo18 standard conditions Fig 1 with imageFig 2 with image from Chen et al., 2022
male germ-line sex determination disrupted, abnormal gdf9umo18/umo18 chemical treatment by environment: estrogen Fig 6 with image from Chen et al., 2022
ovarian follicle stage II absent, abnormal gdf9umo18/umo18 standard conditions Fig 1 with imageFig 2 with imageFig 7 with image from Chen et al., 2022
female organism decreased female fertility, abnormal gdf9umo18/umo18 standard conditions Fig 8 with image from Chen et al., 2022
female germ-line sex determination disrupted, abnormal gdf9umo18/umo18 standard conditions Fig 1 with imageFig 6 with imageFig 8 with image from Chen et al., 2022
female germ-line sex determination normal occurrence, ameliorated dmrt1umo15/umo15; gdf9umo18/umo18 standard conditions Fig 4 with image from Chen et al., 2022
testis hypertrophic, abnormal gdf9umo18/+; amhumo17/umo17 standard conditions Fig. 8 with image from Zhang et al., 2020
ovarian follicle stage I fshr expression increased amount, abnormal gdf9umo18/+; inhaumo19/umo19 standard conditions Fig 9 with image from Chen et al., 2022
ovarian follicle stage I cyp19a1a expression increased amount, abnormal gdf9umo18/+; inhaumo19/umo19 standard conditions Fig 9 with image from Chen et al., 2022
testis hypertrophic, abnormal gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 8 with image from Zhang et al., 2020
ovary increased size, abnormal gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 8 with image from Zhang et al., 2020
ovarian follicle stage I inhbaa expression decreased amount, abnormal gdf9umo18/umo18; inhaumo19/+ standard conditions Fig 9 with image from Chen et al., 2022
female organism decreased female fertility, abnormal gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 8 with image from Chen et al., 2022
ovarian follicle stage I inhbaa expression amount, ameliorated gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 9 with image from Chen et al., 2022
female germ-line sex determination normal occurrence, ameliorated gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 8 with image from Chen et al., 2022
ovarian follicle stage I cyp19a1a expression increased amount, abnormal gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 9 with image from Chen et al., 2022
ovarian follicle stage IV absent, abnormal gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 7 with image from Chen et al., 2022
ovarian follicle development occurrence, ameliorated gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 7 with image from Chen et al., 2022
ovarian follicle stage I fshr expression increased amount, abnormal gdf9umo18/umo18; inhaumo19/umo19 standard conditions Fig 9 with image from Chen et al., 2022
ovary increased size, abnormal fshbumo1/+; gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 9 with image from Zhang et al., 2020
ovary decreased size, abnormal fshbumo1/umo1; gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 9 with image from Zhang et al., 2020
Citations