TALEN

TALEN1-capn3b

ID

ZDB-TALEN-200721-1

Name

TALEN1-capn3b

Previous Names

None

Target

capn3b (1)

Target Sequence 1

5' - GGCAGAAGAACAGAAGT - 3'

Target Sequence 2

5' - GCGGAGCAGCTTCAGTGAGTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 20

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zju20	capn3b

Expression

Gene expression in Wild Types + TALEN1-capn3b

No data available

Phenotype

Phenotype resulting from TALEN1-capn3b

No data available

Phenotype of all Fish created by or utilizing TALEN1-capn3b

Phenotype	Fish	Conditions	Figures
whole organism capn3b expression absent, abnormal	capn3b^zju20/zju20	standard conditions	Fig. S8 from Zhao et al., 2019
whole organism mphosph10 expression increased amount, abnormal	capn3b^zju20/zju20	standard conditions	Fig. S8 from Zhao et al., 2019
liver fabp10a expression absent, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 2 from Chen et al., 2020
muscle capn3b expression absent, abnormal	capn3b^zju20/zju20 (AB)	standard conditions	Fig. 1 from Chen et al., 2020
whole organism capn3b expression absent, abnormal	capn3b^zju20/zju20 (AB)	standard conditions	Fig. 1 from Chen et al., 2020
liver regenerating tissue tp53 expression increased amount, abnormal	capn3b^zju20/zju20 (AB)	amputation: liver	Fig. 9 from Chen et al., 2020
growth delayed, abnormal	capn3b^zju20/zju20 (AB)	standard conditions	Fig. 2 from Chen et al., 2020
exocrine pancreas prss1 expression absent, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 2 from Chen et al., 2020
liver Ab5-chek1 labeling increased amount, abnormal	capn3b^zju20/zju20 (AB)	amputation: liver	Fig. 9 from Chen et al., 2020
regenerating tissue cell population proliferation delayed, abnormal	capn3b^zju20/zju20 (AB)	amputation: liver	Fig. 3 , Fig. 4 from Chen et al., 2020
liver nucleolus Ab1-wee1 labeling increased amount, abnormal	capn3b^zju20/zju20 (AB)	amputation: liver	Fig. 9 from Chen et al., 2020
exocrine pancreas development delayed, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 2 from Chen et al., 2020
whole organism curved, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 2 from Chen et al., 2020
whole organism capn3b expression absent, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 9 from Chen et al., 2020
embryonic liver development delayed, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 2 from Chen et al., 2020
whole organism Ab5-chek1 labeling increased amount, abnormal	capn3b^zju20/zju20 (AB)	heat exposure	Fig. 9 from Chen et al., 2020
liver increased size, abnormal	capn3b^zju20/zju20 (AB)	overcrowding	Fig. 2 from Chen et al., 2020
liver nucleus Ab1-wee1 labeling decreased amount, abnormal	capn3b^zju20/zju20 (AB)	amputation: liver	Fig. 9 from Chen et al., 2020
liver decreased size, abnormal	capn3b^zju20/zju20 (AB)	undercrowding	Fig. 2 from Chen et al., 2020
liver regeneration delayed, abnormal	capn3b^zju20/zju20 (AB)	amputation: liver	Fig. 3 , Fig. 4 from Chen et al., 2020
whole organism decreased size, abnormal	capn3b^zju20/zju20 (AB)	standard conditions	Fig. 2 from Chen et al., 2020

Citations

Include unpublished citations

Chen, F., Huang, D., Shi, H., Gao, C., Wang, Y., Peng, J. (2020) Capn3 depletion causes Chk1 and Wee1 accumulation and disrupts synchronization of cell cycle reentry during liver regeneration after partial hepatectomy. Cell regeneration (London, England). 9:8

1 - 1 of 1

Show