TALEN

TALEN1-nr2f5

ID
ZDB-TALEN-180628-3
Name
TALEN1-nr2f5
Previous Names
None
Target
Target Sequence 1
5' - TGATCCCGGCTCCCAGCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - TTCCCGGTGTCCCGCCAGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el611 nr2f5
Expression
Gene expression in Wild Types + TALEN1-nr2f5
No data available
Phenotype
Phenotype resulting from TALEN1-nr2f5
No data available
Phenotype of all Fish created by or utilizing TALEN1-nr2f5
Phenotype Fish Conditions Figures
cranial neural crest cell EGFP expression decreased amount, abnormal nr2f2el506/+; nr2f5el611/el611; el10Tg/el10Tg; y1Tg/y1Tg standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme sox9a expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ceratobranchial cartilage absent, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 3 with image from Okeke et al., 2022
ectomesenchyme grem2b expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
hyomandibula malformed, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 3 with image from Okeke et al., 2022
ectomesenchyme dlx3b expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
mandibular arch skeleton malformed, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 3 with image from Okeke et al., 2022
ectomesenchyme fli1 expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme dlx2a expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
cranial neural crest cell sox10 expression increased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 2 with image from Okeke et al., 2022
ectomesenchyme prrx1b expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme prrx1a expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme dlx5a expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme twist1a expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme nr2f5 expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
ectomesenchyme ednraa expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 1 with image from Okeke et al., 2022
mandibular arch skeleton dlx6a expression increased distribution, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
pharyngeal arch 2 dlx6a expression increased distribution, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
mandibular arch skeleton dlx5a expression increased distribution, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla dlx6a expression increased distribution, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image,  Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 dlx6a expression increased distribution, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
palatoquadrate arch increased size, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
maxilla dlx5a expression increased distribution, abnormal nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
pharyngeal arch cartilage malformed, abnormal nr2f2el506/el506; nr2f5el611/el611; el2Tg/el2Tg standard conditions Fig. 3 with image from Okeke et al., 2022
cranial neural crest cell EGFP expression decreased amount, abnormal nr2f2el506/el506; nr2f5el611/el611; el10Tg/el10Tg; y1Tg/y1Tg standard conditions Fig. 1 with image from Okeke et al., 2022
mandibular arch skeleton malformed, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 3 with image from Okeke et al., 2022
ceratobranchial cartilage absent, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 3 with image from Okeke et al., 2022
hyomandibula malformed, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 standard conditions Fig. 3 with image from Okeke et al., 2022
pharyngeal arch 2 hand2 expression increased distribution, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pterygoid process increased thickness, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
retroarticular increased amount, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
mandibular arch skeleton msx1a expression increased distribution, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
pharyngeal arch 1 ednraa expression decreased amount, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 5 with image from Barske et al., 2018
maxilla msx1a expression increased amount, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla bony projection sox9a expression mislocalised, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
pharyngeal arch 2 ednraa expression decreased amount, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 5 with image from Barske et al., 2018
pharyngeal arch 1 hand2 expression increased distribution, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image,  Fig. 6 with image from Barske et al., 2018
palatoquadrate arch increased size, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
maxilla bony projection sox9a expression increased amount, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
maxilla msx1a expression increased distribution, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla sox9a expression increased distribution, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
entopterygoid osteoblast decreased amount, abnormal nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611; el10Tg (TU) standard conditions Fig. 2 with image from Barske et al., 2018
mandibular arch skeleton dlx6a expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
mandibular arch skeleton dlx3b expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
pterygoid process increased thickness, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
mandibular arch skeleton dlx5a expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla nkx3-2 expression increased amount, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla dlx6a expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
pharyngeal arch 2 dlx5a expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
pharyngeal arch 1 nkx3-2 expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
palatoquadrate arch increased thickness, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
maxilla dlx3b expression increased amount, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
dorsal hyoid arch decreased size, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image,  Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 dlx5a expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
maxilla dlx3b expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
maxilla dlx5a expression increased distribution, abnormal nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 4 with image from Barske et al., 2018
palatoquadrate arch increased size, exacerbated nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
pharyngeal arch 2 hand2 expression spatial pattern, ameliorated edn1tf216b/tf216b; nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 hand2 expression spatial pattern, ameliorated edn1tf216b/tf216b; nr2f1bel523/+; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
Meckel's cartilage morphology, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 dlx5a expression spatial pattern, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 2 dlx6a expression increased distribution, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 dlx6a expression spatial pattern, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
quadrate-anguloarticular joint morphology, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 2 dlx5a expression increased distribution, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/+; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
Meckel's cartilage morphology, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 2 prrx1b expression increased distribution, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 prrx1b expression spatial pattern, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 1 jag1b expression spatial pattern, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
pharyngeal arch 2 jag1b expression increased distribution, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
quadrate-anguloarticular joint morphology, ameliorated edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
palatoquadrate arch increased size, abnormal edn1tf216b/tf216b; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 6 with image from Barske et al., 2018
neural crest cell migration decreased occurrence, abnormal nr2f1ael512/el512; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.