TALEN

TALEN1-ahr1a

ID

ZDB-TALEN-171017-1

Name

TALEN1-ahr1a

Previous Names

None

Target

ahr1a (1)

Target Sequence 1

5' - GAAGTTCTGGCCAGCTTGGC - 3'

Target Sequence 2

5' - GGATACGATCTCCTGTGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mu152	ahr1a
mu153	ahr1a
mu154	ahr1a

Expression

Gene expression in Wild Types + TALEN1-ahr1a

No data available

Phenotype

Phenotype resulting from TALEN1-ahr1a

No data available

Phenotype of all Fish created by or utilizing TALEN1-ahr1a

Phenotype	Fish	Conditions	Figures
primordial hindbrain channel cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. 5 from Sugden et al., 2017
dorsal longitudinal anastomotic vessel cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017
posterior cardinal vein cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017
dorsal aorta cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017
intersegmental vessel cyp1a expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
central artery cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. 5 from Sugden et al., 2017
lateral dorsal aorta cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. 5 from Sugden et al., 2017
intersegmental vessel cyp1b1 expression increased amount, abnormal	ahr1a^mu153/mu153	chemical treatment by environment: beta-naphthoflavone	Fig. 5 , Fig. S3 from Sugden et al., 2017
dorsal longitudinal anastomotic vessel cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017
dorsal longitudinal anastomotic vessel cxcr4a expression increased amount, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: nifedipine	Fig. 6 from Sugden et al., 2017
intestine vasculature cxcr4a expression increased amount, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: nifedipine	Fig. 6 from Sugden et al., 2017
trunk vasculature cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
integument cyp1b1 expression amount, ameliorated	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 5 from Sugden et al., 2017
lateral dorsal aorta cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
central artery cxcr4a expression increased amount, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: nifedipine	Fig. 6 from Sugden et al., 2017
posterior cardinal vein cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. S3 from Sugden et al., 2017
dorsal aorta cxcr4a expression increased amount, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: nifedipine	Fig. 6 from Sugden et al., 2017
basal communicating artery cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
lateral dorsal aorta cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. 4 from Sugden et al., 2017
posterior communicating artery cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. 4 from Sugden et al., 2017
dorsal longitudinal anastomotic vessel cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. S3 from Sugden et al., 2017
posterior communicating artery cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
dorsal aorta cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017
posterior cardinal vein cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017
trunk vasculature cxcr4a expression increased amount, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: nifedipine	Fig. 6 from Sugden et al., 2017
eye cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. 4 from Sugden et al., 2017
dorsal aorta cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. S3 from Sugden et al., 2017
central artery cxcr4a expression amount, ameliorated	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 6 from Sugden et al., 2017
trunk vasculature cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. 4 from Sugden et al., 2017
basilar artery cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
basal communicating artery cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. 4 from Sugden et al., 2017
eye cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 4 from Sugden et al., 2017
intestine vasculature cxcr4a expression amount, ameliorated	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. 6 from Sugden et al., 2017
basilar artery cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. 4 from Sugden et al., 2017
intersegmental vessel cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	control	Fig. S3 from Sugden et al., 2017
intersegmental vessel cyp1a expression absent, abnormal	ahr2^{hu3335/hu3335}; ahr1a^mu153/mu153; ahr1b^mu145/mu145	chemical treatment by environment: beta-naphthoflavone	Fig. S3 from Sugden et al., 2017

Citations