TALEN

TALEN1-prrx1b

ID
ZDB-TALEN-170303-3
Name
TALEN1-prrx1b
Previous Names
None
Target
Target Sequence 1
5' - TGGCGAAACGGGCAGGACTA - 3'
Target Sequence 2
5' - TGTATCACTGCCACTCGTTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el491 prrx1b
Expression
Gene expression in Wild Types + TALEN1-prrx1b
No data available
Phenotype
Phenotype resulting from TALEN1-prrx1b
No data available
Phenotype of all Fish created by or utilizing TALEN1-prrx1b
Phenotype Fish Conditions Figures
cardiac muscle cell cell population proliferation decreased occurrence, abnormal prrx1bel491/el491 standard conditions Fig. 1. with image from de Bakker et al., 2021
heart connective tissue replacement involved in inflammatory response wound healing increased occurrence, abnormal prrx1bel491/el491 standard conditions Fig. 1. with image from de Bakker et al., 2021
cardiac muscle cell cell population proliferation decreased occurrence, abnormal prrx1bel491/el491 cold damage: heart Fig. 5. with image from de Bakker et al., 2021
cardiac muscle cell cell population proliferation normal process quality, ameliorated prrx1bel491/el491 cold damage: heart, chemical treatment by environment: Human Heregulin-b1 Fig. 5. with image from de Bakker et al., 2021
cardiac muscle cell ab2-pcna labeling increased amount, abnormal prrx1bel491/el491 cold damage: heart Fig. 1. with image from de Bakker et al., 2021
heart connective tissue replacement involved in inflammatory response wound healing increased occurrence, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 4. with image from de Bakker et al., 2021
ventricular epicardium nrg1 expression decreased amount, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 5. with image from de Bakker et al., 2021
heart fibroblast tgfb1a expression increased amount, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 4. with image from de Bakker et al., 2021
heart fibroblast col11a1b expression increased amount, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 4. with image from de Bakker et al., 2021
heart collagen biosynthetic process increased rate, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 4. with image from de Bakker et al., 2021
extracellular matrix organization decreased process quality, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 3. with image from de Bakker et al., 2021
collagen biosynthetic process decreased process quality, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 3. with image from de Bakker et al., 2021
blood coagulation, fibrin clot formation decreased process quality, abnormal prrx1bel491/el491; cz1701Tg/cz1701Tg; pd42Tg/pd42Tg cold damage: heart, chemical treatment by environment: tamoxifen Fig. 3. with image from de Bakker et al., 2021
heart morphology, abnormal prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
pharyngeal arch 2 postero-dorsal region barx1 expression increased amount, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression mislocalised, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression increased distribution, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression mislocalised, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
pharyngeal arch ventral region barx1 expression decreased amount, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 9 with image from Barske et al., 2016
entopterygoid absent, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
hyomandibula morphology, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image,  text only from Barske et al., 2016
palatoquadrate cartilage mislocalised, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image,  Fig. 8 with image,  text only from Barske et al., 2016
pharyngeal arch 2 barx1 expression increased distribution, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
opercle decreased size, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions text only from Barske et al., 2016
palatoquadrate cartilage morphology, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image,  Fig. 8 with image,  text only from Barske et al., 2016
hyomandibula fused with inner ear, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image,  text only from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region jag1b expression decreased amount, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 8 with image from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression increased amount, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression increased amount, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
hyomandibula malformed, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions text only from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression increased distribution, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
palatoquadrate cartilage fused with neurocranial trabecula, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions text only from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression increased distribution, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
palatoquadrate cartilage fused with inner ear, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image,  Fig. 8 with image,  text only from Barske et al., 2016
pharyngeal arch ventral region dlx5a expression decreased amount, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 9 with image from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression mislocalised, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 7 with image from Barske et al., 2016
hyomandibular foramen absent, abnormal prrx1ael558/el558; prrx1bel491/el491 standard conditions text only from Barske et al., 2016
determination of heart left/right asymmetry disrupted, abnormal prrx1ael558/el558; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal prrx1ael558/el558; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1ael558/el558; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal prrx1ahu13685/hu13685; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal prrx1ahu13685/hu13685; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1ahu13685/hu13685; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
palatoquadrate cartilage mislocalised, abnormal jag1bb1105/b1105; prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 8 with image from Barske et al., 2016
palatoquadrate cartilage morphology, abnormal jag1bb1105/b1105; prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 8 with image from Barske et al., 2016
palatoquadrate cartilage fused with inner ear, abnormal jag1bb1105/b1105; prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 8 with image from Barske et al., 2016
pharyngeal arch cartilage ventral region morphology, abnormal edn1tf216b/tf216b; jag1bb1105/b1105; prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 9 with image from Barske et al., 2016
Meckel's cartilage length, ameliorated edn1tf216b/tf216b; jag1bb1105/b1105; prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 9 with image from Barske et al., 2016
ceratohyal cartilage size, ameliorated edn1tf216b/tf216b; jag1bb1105/b1105; prrx1ael558/el558; prrx1bel491/el491 standard conditions Fig. 9 with image from Barske et al., 2016
Citations