TALEN

TALEN2-sphk2

ID

ZDB-TALEN-151201-1

Name

TALEN2-sphk2

Previous Names

None

Target

sphk2 (1)

Target Sequence 1

5' - GCAAAAGCATGTTGCCTCGT - 3'

Target Sequence 2

5' - GAATGGATTGACCAGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 16

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wcm2	sphk2

Expression

Gene expression in Wild Types + TALEN2-sphk2

No data available

Phenotype

Phenotype resulting from TALEN2-sphk2

No data available

Phenotype of all Fish created by or utilizing TALEN2-sphk2

Phenotype	Fish	Conditions	Figures
gastrulation delayed, abnormal	sphk2^wcm2/wcm2	control	Fig. 2 from Mendelson et al., 2017
cell migration to the midline involved in heart development decreased occurrence, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 , Fig. 4 from Mendelson et al., 2015
oocyte cers2b expression increased amount, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 7 from Mendelson et al., 2017
post-vent region epithelium blistered, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
yolk syncytial layer increased width, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 3 from Mendelson et al., 2017
post-vent region epithelium blistered, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
EVL epiboly delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 3 from Mendelson et al., 2017
whole organism sphingosine increased amount, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 1 from Mendelson et al., 2017
actin filament organization disrupted, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 3 from Mendelson et al., 2017
yolk syncytial layer increased width, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
epiboly delayed, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 1 , Fig. 2 from Mendelson et al., 2017
epiboly delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: 4-[[4-(4-chlorophenyl)-2-thiazolyl]amino]phenol	Fig. 3 from Mendelson et al., 2017
EVL epiboly delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
heart edematous, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
whole organism cers2b expression increased amount, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 4 from Mendelson et al., 2017
epiboly delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
yolk actin cytoskeleton organization disrupted, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 3 from Mendelson et al., 2017
actin filament organization disrupted, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
gastrulation delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 2 from Mendelson et al., 2017
heart tube split bilaterally, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
heart tube increased amount, abnormal	sphk2^wcm2/wcm2	control	Fig. 2 from Mendelson et al., 2017
heart tube split bilaterally, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 , Fig. 4 from Mendelson et al., 2015
embryonic heart tube formation decreased occurrence, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 , Fig. 4 from Mendelson et al., 2015
oocyte sphingoid 1-phosphate absent, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 7 from Mendelson et al., 2017
embryonic heart tube formation decreased occurrence, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
yolk actin cytoskeleton organization disrupted, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: 4-[[4-(4-chlorophenyl)-2-thiazolyl]amino]phenol	Fig. 3 from Mendelson et al., 2017
EVL junctional membrane complex morphology, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 3 from Mendelson et al., 2017
yolk actin cytoskeleton organization disrupted, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
yolk syncytial layer microtubule cytoskeleton increased length, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 3 from Mendelson et al., 2017
actin filament organization disrupted, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: 4-[[4-(4-chlorophenyl)-2-thiazolyl]amino]phenol	Fig. 3 from Mendelson et al., 2017
yolk syncytial layer microtubule cytoskeleton increased length, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
oocyte sphingosine increased amount, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 7 from Mendelson et al., 2017
EVL epiboly delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: 4-[[4-(4-chlorophenyl)-2-thiazolyl]amino]phenol	Fig. 3 from Mendelson et al., 2017
heart tube increased amount, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 2 from Mendelson et al., 2017
whole organism sphingosine 1-phosphate decreased amount, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 1 from Mendelson et al., 2017
epiboly delayed, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: sphingosine	Fig. 2 , Fig. 3 from Mendelson et al., 2017
EVL junctional membrane complex morphology, abnormal	sphk2^wcm2/wcm2	chemical treatment by environment: EC 2.7.1.91 (sphingosine kinase) inhibitor	Fig. 3 from Mendelson et al., 2017
cell migration to the midline involved in heart development decreased occurrence, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
heart edematous, abnormal	sphk2^wcm2/wcm2	standard conditions	Fig. 3 from Mendelson et al., 2015
whole organism asah1a expression increased amount, abnormal	sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism asah2 expression decreased amount, abnormal	sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
margin decreased diameter, abnormal	sphk2^wcm2/wcm2 + MO1-cers2b	standard conditions	Fig. 4 from Mendelson et al., 2017
gastrulation delayed, abnormal	sphk2^wcm2/wcm2 + MO1-cers2b	standard conditions	Fig. 4 from Mendelson et al., 2017
yolk hourglass-shaped, abnormal	sphk2^wcm2/wcm2 + MO1-cers2b	standard conditions	Fig. 4 from Mendelson et al., 2017
whole organism necrotic, abnormal	cers2b^wcm18/wcm18; sphk2^wcm2/wcm2	standard conditions	Fig. 4 from Mendelson et al., 2017
whole organism dead, abnormal	cers2b^wcm18/wcm18; sphk2^wcm2/wcm2	standard conditions	Fig. 4 from Mendelson et al., 2017
whole organism dnajc3a expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
liver increased size, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism gpx1a expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism il1b expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
hepatocyte increased size, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
liver lipid increased amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism txnl1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism col1a1a expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism xbp1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism atf4a expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism asah1a expression increased amount, abnormal	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism txnl4a expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism edem1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism asah1b expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism nfe2l2a expression increased amount, abnormal	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism gpx4a expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism prdx4 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism serpina1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism ern1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism sgpl1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism atf6 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism tnfa expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism sphk2 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism bcl2l11 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism hspa5 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism sgpp1b expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism ddit3 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism sod2 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism asah2 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 5 from Park et al., 2019
whole organism bida expression increased amount, abnormal	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism hsp90b1 expression increased amount, abnormal	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism nfkb1 expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism gadd45aa expression increased amount, abnormal	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019
whole organism baxb expression amount, ameliorated	kdsr^{muz106/muz106}; sphk2^wcm2/wcm2 (AB/TU)	standard conditions	Fig. 6 from Park et al., 2019

Citations

Include unpublished citations

Mendelson, K., Lan, Y., Hla, T., Evans, T. (2015) Maternal or zygotic sphingosine kinase is required to regulate zebrafish cardiogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 244(8):948-54

1 - 1 of 1

Show