Morpholino

MO1-csde1

ID
ZDB-MRPHLNO-260126-2
Name
MO1-csde1
Previous Names
None
Target
Sequence
5' - GGGTCAAAACTCATCTTGTTCTGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-csde1
No data available
Phenotype
Phenotype resulting from MO1-csde1
Phenotype Fish Figures
beta-catenin binding decreased efficacy, abnormal TU + MO1-csde1 Fig. 5. with image from Li et al., 2023
endothelial cell Ab17-ctnnb labeling decreased amount, abnormal y1Tg/y1Tg + MO1-csde1 Fig. 5. with image from Li et al., 2023
endothelial cell lef1 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 3. with image from Li et al., 2023
endothelial cell tcf3a expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 3. with image from Li et al., 2023
endothelial cell ccnd1 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 3. with imageFig. 6. with image from Li et al., 2023
endothelial cell myb expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 6. with image from Li et al., 2023
endothelial cell cdk2 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 3. with imageFig. 6. with image from Li et al., 2023
endothelial cell runx1 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 6. with image from Li et al., 2023
endothelial cell axin2 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 Fig. 3. with imageFig. 6. with image from Li et al., 2023
endothelial cell beta-catenin binding decreased occurrence, abnormal y1Tg/y1Tg + MO1-csde1 Fig. 5. with image from Li et al., 2023
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO1-csde1 Fig. 1. with image from Li et al., 2023
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-csde1 Fig. 1. with image from Li et al., 2023
hematopoietic multipotent progenitor cell mRNA binding decreased process quality, abnormal y1Tg/y1Tg + MO1-csde1 Fig. 5. with image from Li et al., 2023
trunk ab8-ctnnb labeling decreased amount, abnormal TU + MO1-csde1 Fig. 5. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO1-csde1 Fig. 1. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-csde1 Fig. 1. with image from Li et al., 2023
Phenotype of all Fish created by or utilizing MO1-csde1
Phenotype Fish Conditions Figures
endothelial cell runx1 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 6. with image from Li et al., 2023
endothelial cell tcf3a expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell cdk2 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 3. with imageFig. 6. with image from Li et al., 2023
endothelial cell myb expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 6. with image from Li et al., 2023
endothelial cell axin2 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 3. with imageFig. 6. with image from Li et al., 2023
endothelial cell ccnd1 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 3. with imageFig. 6. with image from Li et al., 2023
endothelial cell lef1 expression decreased amount, abnormal s843Tg/s843Tg + MO1-csde1 standard conditions Fig. 3. with image from Li et al., 2023
endothelial cell beta-catenin binding decreased occurrence, abnormal y1Tg/y1Tg + MO1-csde1 standard conditions Fig. 5. with image from Li et al., 2023
endothelial cell Ab17-ctnnb labeling decreased amount, abnormal y1Tg/y1Tg + MO1-csde1 standard conditions Fig. 5. with image from Li et al., 2023
hematopoietic multipotent progenitor cell mRNA binding decreased process quality, abnormal y1Tg/y1Tg + MO1-csde1 standard conditions Fig. 5. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO1-csde1 standard conditions Fig. 1. with image from Li et al., 2023
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO1-csde1 standard conditions Fig. 1. with image from Li et al., 2023
beta-catenin binding decreased efficacy, abnormal TU + MO1-csde1 standard conditions Fig. 5. with image from Li et al., 2023
trunk ab8-ctnnb labeling decreased amount, abnormal TU + MO1-csde1 standard conditions Fig. 5. with image from Li et al., 2023
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-csde1 standard conditions Fig. 1. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-csde1 standard conditions Fig. 1. with image from Li et al., 2023
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal zf169Tg/zf169Tg + MO1-csde1 standard conditions Fig. 6. with image from Li et al., 2023
Citations