Morpholino

MO4-lmo4la

ID
ZDB-MRPHLNO-240726-1
Name
MO4-lmo4la
Previous Names
  • MO4-lmo4a
Target
Sequence
5' - ACACTGGAGGAGAAAAACCAAGCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-lmo4la
No data available
Phenotype
Phenotype resulting from MO4-lmo4la
Phenotype of all Fish created by or utilizing MO4-lmo4la
Phenotype Fish Conditions Figures
embryonic structure eya1 expression decreased amount, abnormal TU + MO4-lmo4la standard conditions Figure 5 with image from Sun et al., 2023
semicircular canal development disrupted, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle bmp2b expression increased distribution, abnormal TU + MO4-lmo4la standard conditions Figure 5 with image from Sun et al., 2023
otic vesicle development process quality, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
utricle hair cell decreased amount, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
semicircular canal morphology, abnormal TU + MO4-lmo4la standard conditions Figure 3 with imageFigure 5 with image from Sun et al., 2023
otic vesicle decreased size, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
semicircular canal morphology, ameliorated TU + MO4-lmo4la chemical treatment by injection: dorsomorphin Figure 5 with image from Sun et al., 2023
otic epithelium increased thickness, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle bmp2b expression mislocalised, abnormal TU + MO4-lmo4la standard conditions Figure 5 with image from Sun et al., 2023
statoacoustic (VIII) ganglion decreased area, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle bmp4 expression increased distribution, abnormal TU + MO4-lmo4la standard conditions Figure 5 with image from Sun et al., 2023
otic vesicle bmp4 expression mislocalised, abnormal TU + MO4-lmo4la standard conditions Figure 5 with image from Sun et al., 2023
saccule hair cell decreased amount, abnormal TU + MO4-lmo4la standard conditions Figure 3 with image from Sun et al., 2023
semicircular canal morphology, ameliorated w30Tg + MO4-lmo4la heat shock Figure 5 with image from Sun et al., 2023
Citations