Morpholino

MO1-syn3

ID
ZDB-MRPHLNO-240219-15
Name
MO1-syn3
Previous Names
None
Target
Sequence
5' - TCGATAACTAAGCGATGCCATCTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-syn3
Expressed Gene Anatomy Figures
gfap Figure 2 with image from Faustini et al., 2022
isl1a Figure 2 with image from Faustini et al., 2022
neurog1 Figure 2 with image from Faustini et al., 2022
Phenotype
Phenotype resulting from MO1-syn3
Phenotype Fish Figures
cranial ganglion neurog1 expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
diencephalon EGFP expression decreased amount, abnormal nl1Tg + MO1-syn3 (AB) Figure 3 with image,  Figure 4 with image from Faustini et al., 2022
diencephalon neurog1 expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
diencephalon dopaminergic neuron isl1a expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
diencephalon dorsal region ab4-th labeling decreased distribution, abnormal nl1Tg + MO1-syn3 (AB) Figure 4 with image from Faustini et al., 2022
diencephalon neuron neurog1 expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
forebrain gfap expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
head malformed, abnormal AB + MO1-syn3 Figure 1 with image from Faustini et al., 2022
heart contraction increased rate of continuous process, abnormal AB + MO1-syn3 Figure 1 with image from Faustini et al., 2022
hindbrain neurog1 expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
hindbrain gfap expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
hindbrain dopaminergic neuron isl1a expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
locomotion increased process quality, abnormal AB + MO1-syn3 Figure 1 with image from Faustini et al., 2022
midbrain neurog1 expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
midbrain gfap expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
midbrain hindbrain boundary gfap expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
midbrain hindbrain boundary EGFP expression decreased amount, abnormal nl1Tg + MO1-syn3 (AB) Figure 3 with image,  Figure 4 with image from Faustini et al., 2022
post-vent region kinked, abnormal AB + MO1-syn3 Figure 1 with image from Faustini et al., 2022
spinal cord neuron projection GFP expression absent, abnormal sb2Tg + MO1-syn3 (AB) Figure 3 with image from Faustini et al., 2022
spinal cord neuron projection EGFP expression decreased distribution, abnormal nl1Tg + MO1-syn3 (AB) Figure 4 with image from Faustini et al., 2022
spinal cord neuron projection decreased length, abnormal nl1Tg + MO1-syn3 (AB) Figure 4 with image from Faustini et al., 2022
swimming behavior decreased process quality, abnormal nl1Tg + MO1-syn3 (AB) Figure 3 with image from Faustini et al., 2022
telencephalon EGFP expression decreased amount, abnormal nl1Tg + MO1-syn3 (AB) Figure 3 with image,  Figure 4 with image from Faustini et al., 2022
telencephalon neurog1 expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
telencephalon dopaminergic neuron isl1a expression decreased amount, abnormal AB + MO1-syn3 Figure 2 with image from Faustini et al., 2022
telencephalon ventral region ab4-th labeling decreased distribution, abnormal nl1Tg + MO1-syn3 (AB) Figure 4 with image from Faustini et al., 2022
whole organism Ab1-syn3 labeling decreased amount, abnormal nl1Tg + MO1-syn3 (AB) Figure 4 with image from Faustini et al., 2022
Phenotype of all Fish created by or utilizing MO1-syn3
Phenotype Fish Conditions Figures
midbrain gfap expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
hindbrain dopaminergic neuron isl1a expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
midbrain hindbrain boundary gfap expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
cranial ganglion neurog1 expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
diencephalon neurog1 expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
forebrain gfap expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
midbrain neurog1 expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
heart contraction increased rate of continuous process, abnormal AB + MO1-syn3 control Figure 1 with image from Faustini et al., 2022
diencephalon neuron neurog1 expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
diencephalon dopaminergic neuron isl1a expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
locomotion increased process quality, abnormal AB + MO1-syn3 control Figure 1 with image from Faustini et al., 2022
head malformed, abnormal AB + MO1-syn3 control Figure 1 with image from Faustini et al., 2022
post-vent region kinked, abnormal AB + MO1-syn3 control Figure 1 with image from Faustini et al., 2022
hindbrain neurog1 expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
telencephalon dopaminergic neuron isl1a expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
telencephalon neurog1 expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
hindbrain gfap expression decreased amount, abnormal AB + MO1-syn3 control Figure 2 with image from Faustini et al., 2022
whole organism Ab1-syn3 labeling decreased amount, abnormal nl1Tg + MO1-syn3 (AB) control Figure 4 with image from Faustini et al., 2022
swimming behavior decreased process quality, abnormal nl1Tg + MO1-syn3 (AB) control Figure 3 with image from Faustini et al., 2022
midbrain hindbrain boundary EGFP expression decreased amount, abnormal nl1Tg + MO1-syn3 (AB) control Figure 3 with image,  Figure 4 with image from Faustini et al., 2022
telencephalon EGFP expression decreased amount, abnormal nl1Tg + MO1-syn3 (AB) control Figure 3 with image,  Figure 4 with image from Faustini et al., 2022
spinal cord neuron projection decreased length, abnormal nl1Tg + MO1-syn3 (AB) control Figure 4 with image from Faustini et al., 2022
diencephalon EGFP expression decreased amount, abnormal nl1Tg + MO1-syn3 (AB) control Figure 3 with image,  Figure 4 with image from Faustini et al., 2022
spinal cord neuron projection EGFP expression decreased distribution, abnormal nl1Tg + MO1-syn3 (AB) control Figure 4 with image from Faustini et al., 2022
diencephalon dorsal region ab4-th labeling decreased distribution, abnormal nl1Tg + MO1-syn3 (AB) control Figure 4 with image from Faustini et al., 2022
telencephalon ventral region ab4-th labeling decreased distribution, abnormal nl1Tg + MO1-syn3 (AB) control Figure 4 with image from Faustini et al., 2022
spinal cord neuron projection GFP expression absent, abnormal sb2Tg + MO1-syn3 (AB) control Figure 3 with image from Faustini et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.