Morpholino

MO1-gldc

ID
ZDB-MRPHLNO-240216-1
Name
MO1-gldc
Previous Names
None
Target
Sequence
5' - ACAGCTCTTACCTCAACTCCGAGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gldc
No data available
Phenotype
Phenotype resulting from MO1-gldc
No data available
Phenotype of all Fish created by or utilizing MO1-gldc
Phenotype Fish Conditions Figures
whole organism viability, abnormal WT + MO1-gldc + MO2-gldc control Figure 1 with image from Weaver et al., 2022
pericardium edematous, abnormal WT + MO1-gldc + MO2-gldc control Figure 1 with image from Weaver et al., 2022
cloaca pax2a expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 5 with image from Weaver et al., 2022
pronephric proximal convoluted tubule slc20a1a expression decreased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 3 with image from Weaver et al., 2022
cloaca gata3 expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 5 with image from Weaver et al., 2022
pronephric distal early tubule irx1a expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 4 with image from Weaver et al., 2022
pronephric distal late tubule tbx2b expression decreased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 4 with image from Weaver et al., 2022
migratory cranial neural crest dlx2a expression spatial pattern, abnormal WT + MO1-gldc + MO2-gldc control Figure 2 with image from Weaver et al., 2022
cloaca apoptotic process increased process quality, abnormal WT + MO1-gldc + MO2-gldc control Figure 5 with image from Weaver et al., 2022
brain apoptotic process increased process quality, abnormal WT + MO1-gldc + MO2-gldc control Figure 2 with image from Weaver et al., 2022
pronephric distal early tubule irx3b expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 4 with image from Weaver et al., 2022
Meckel's cartilage morphology, abnormal WT + MO1-gldc + MO2-gldc control Figure 1 with image from Weaver et al., 2022
pronephric distal late tubule tbx2a expression decreased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 4 with image from Weaver et al., 2022
cloaca increased area, abnormal WT + MO1-gldc + MO2-gldc control Figure 5 with image from Weaver et al., 2022
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 3 with image from Weaver et al., 2022
pharyngeal arch decreased amount, abnormal WT + MO1-gldc + MO2-gldc control Figure 1 with image from Weaver et al., 2022
ventricular system swollen, abnormal WT + MO1-gldc + MO2-gldc control Figure 1 with image from Weaver et al., 2022
rhombomere 3 egr2b expression spatial pattern, abnormal WT + MO1-gldc + MO2-gldc control Figure 2 with image from Weaver et al., 2022
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 3 with image,  Figure 6 with image from Weaver et al., 2022
pronephric distal late tubule mecom expression decreased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 4 with image from Weaver et al., 2022
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 3 with image,  Figure 6 with image from Weaver et al., 2022
pronephros apoptotic process increased process quality, abnormal WT + MO1-gldc + MO2-gldc control Figure 2 with image from Weaver et al., 2022
renal filtration decreased process quality, abnormal WT + MO1-gldc + MO2-gldc control Figure 3 with image from Weaver et al., 2022
cloaca cell aggregated, abnormal WT + MO1-gldc + MO2-gldc control Figure 5 with image from Weaver et al., 2022
cloaca mecom expression increased distribution, abnormal WT + MO1-gldc + MO2-gldc control Figure 5 with image from Weaver et al., 2022
ventricular system increased volume, abnormal WT + MO1-gldc + MO2-gldc control Figure 2 with image from Weaver et al., 2022
rhombomere mecom expression spatial pattern, abnormal WT + MO1-gldc + MO2-gldc control Figure 2 with image from Weaver et al., 2022
head necrotic, abnormal WT + MO1-gldc + MO2-gldc control Figure 1 with image from Weaver et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.