Morpholino

MO2-tfg

ID
ZDB-MRPHLNO-240103-2
Name
MO2-tfg
Previous Names
  • tfg-E3I3-MO (1)
Target
Sequence
5' - TCTGAAGCCTAAATCTGACCTTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfg
Phenotype
Phenotype resulting from MO2-tfg
Phenotype Fish Figures
brain apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
motor neuron axon decreased length, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
post-vent region curved, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
swimming behavior decreased process quality, abnormal ml2Tg + MO2-tfg FIGURE 5 with image from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lrp5 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism wnt8a expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism mycn expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism myca expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism viability, abnormal ml2Tg + MO2-tfg FIGURE 5 with image from Chen et al., 2022
Phenotype of all Fish created by or utilizing MO2-tfg
Phenotype Fish Conditions Figures
whole organism lrp5 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism wnt8a expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism myca expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism mycn expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
brain apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
whole organism viability, abnormal ml2Tg + MO2-tfg control FIGURE 5 with image from Chen et al., 2022
swimming behavior decreased process quality, abnormal ml2Tg + MO2-tfg control FIGURE 5 with image from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
motor neuron axon decreased length, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
post-vent region curved, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
Citations