Morpholino

MO2-tfg

ID
ZDB-MRPHLNO-240103-2
Name
MO2-tfg
Previous Names
  • tfg-E3I3-MO (1)
Target
Sequence
5' - TCTGAAGCCTAAATCTGACCTTCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfg
Expressed Gene Anatomy Figures
axin1 FIGURE 6 with image from Chen et al., 2022
axin2 FIGURE 6 with image from Chen et al., 2022
ctnnb1 FIGURE 6 with image from Chen et al., 2022
fzd7a FIGURE 6 with image from Chen et al., 2022
fzd7b FIGURE 6 with image from Chen et al., 2022
lef1 FIGURE 6 with image from Chen et al., 2022
lrp5 FIGURE 6 with image from Chen et al., 2022
lrp6 FIGURE 6 with image from Chen et al., 2022
myca FIGURE 6 with image from Chen et al., 2022
mycn FIGURE 6 with image from Chen et al., 2022
wnt8a FIGURE 6 with image from Chen et al., 2022
wnt9a FIGURE 6 with image from Chen et al., 2022
Phenotype
Phenotype resulting from MO2-tfg
Phenotype Fish Figures
brain apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
motor neuron axon decreased length, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
post-vent region curved, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg FIGURE 4 with image from Chen et al., 2022
swimming behavior decreased process quality, abnormal ml2Tg + MO2-tfg FIGURE 5 with image from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism wnt8a expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lrp5 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism mycn expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism myca expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal WT + MO2-tfg FIGURE 6 with image from Chen et al., 2022
whole organism viability, abnormal ml2Tg + MO2-tfg FIGURE 5 with image from Chen et al., 2022
Phenotype of all Fish created by or utilizing MO2-tfg
Phenotype Fish Conditions Figures
whole organism lrp5 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism wnt8a expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism myca expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism mycn expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal WT + MO2-tfg control FIGURE 6 with image from Chen et al., 2022
brain apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
whole organism viability, abnormal ml2Tg + MO2-tfg control FIGURE 5 with image from Chen et al., 2022
swimming behavior decreased process quality, abnormal ml2Tg + MO2-tfg control FIGURE 5 with image from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
motor neuron axon decreased length, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
post-vent region curved, abnormal ml2Tg + MO2-tfg control FIGURE 4 with image from Chen et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.