Morpholino

MO1-ube3d

ID
ZDB-MRPHLNO-210104-1
Name
MO1-ube3d
Previous Names
None
Target
Sequence
5' - ATCTTAGCGTGTACCTGTTGGCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ube3d
No data available
Phenotype
Phenotype resulting from MO1-ube3d
Phenotype Fish Figures
angiogenesis increased process quality, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) Fig. 7 with image from Xia et al., 2020
blood vessel mCherry expression increased amount, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) Fig. 7 with image from Xia et al., 2020
blood vessel EGFP expression increased amount, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) Fig. 7 with image from Xia et al., 2020
blood vessel mCherry expression increased distribution, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) Fig. 7 with image from Xia et al., 2020
blood vessel EGFP expression increased distribution, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) Fig. 7 with image from Xia et al., 2020
eye decreased size, abnormal TU + MO1-ube3d Fig. 1 with image,  Fig. 2 with image from Xia et al., 2020
eye apoptotic process increased process quality, abnormal TU + MO1-ube3d Fig. 3 with image from Xia et al., 2020
eye development delayed, abnormal TU + MO1-ube3d Fig. 1 with image,  Fig. 2 with image from Xia et al., 2020
locomotory behavior decreased process quality, abnormal TU + MO1-ube3d Fig. S3 from Xia et al., 2020
photoreceptor outer segment layer decreased thickness, abnormal TU + MO1-ube3d Fig. 5 with image from Xia et al., 2020
photoreceptor outer segment layer pigment granule increased amount, abnormal TU + MO1-ube3d Fig. 5 with image from Xia et al., 2020
retina decreased thickness, abnormal TU + MO1-ube3d Fig. 4 with image from Xia et al., 2020
retinal ganglion cell decreased amount, abnormal TU + MO1-ube3d Fig. 4 with image from Xia et al., 2020
retinal inner nuclear layer decreased thickness, abnormal TU + MO1-ube3d Fig. 4 with image from Xia et al., 2020
retinal inner plexiform layer decreased thickness, abnormal TU + MO1-ube3d Fig. 4 with image from Xia et al., 2020
retinal outer nuclear layer decreased thickness, abnormal TU + MO1-ube3d Fig. 4 with image from Xia et al., 2020
retinal outer plexiform layer decreased thickness, abnormal TU + MO1-ube3d Fig. 4 with image from Xia et al., 2020
Phenotype of all Fish created by or utilizing MO1-ube3d
Phenotype Fish Conditions Figures
locomotory behavior decreased process quality, abnormal TU + MO1-ube3d control Fig. S3 from Xia et al., 2020
retinal inner plexiform layer decreased thickness, abnormal TU + MO1-ube3d control Fig. 4 with image from Xia et al., 2020
eye apoptotic process increased process quality, abnormal TU + MO1-ube3d control Fig. 3 with image from Xia et al., 2020
retina decreased thickness, abnormal TU + MO1-ube3d control Fig. 4 with image from Xia et al., 2020
eye development delayed, abnormal TU + MO1-ube3d control Fig. 1 with image,  Fig. 2 with image from Xia et al., 2020
eye decreased size, abnormal TU + MO1-ube3d control Fig. 1 with image,  Fig. 2 with image from Xia et al., 2020
retinal outer plexiform layer decreased thickness, abnormal TU + MO1-ube3d control Fig. 4 with image from Xia et al., 2020
retinal outer nuclear layer decreased thickness, abnormal TU + MO1-ube3d control Fig. 4 with image from Xia et al., 2020
pigment cell melanosome distended, abnormal TU + MO1-ube3d chemical treatment: (R)-adrenaline Fig. 6 with image from Xia et al., 2020
photoreceptor outer segment layer decreased thickness, abnormal TU + MO1-ube3d control Fig. 5 with image from Xia et al., 2020
retinal ganglion cell decreased amount, abnormal TU + MO1-ube3d control Fig. 4 with image from Xia et al., 2020
retinal inner nuclear layer decreased thickness, abnormal TU + MO1-ube3d control Fig. 4 with image from Xia et al., 2020
photoreceptor outer segment layer pigment granule increased amount, abnormal TU + MO1-ube3d control Fig. 5 with image from Xia et al., 2020
blood vessel mCherry expression increased distribution, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) control Fig. 7 with image from Xia et al., 2020
blood vessel mCherry expression increased amount, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) control Fig. 7 with image from Xia et al., 2020
blood vessel EGFP expression increased distribution, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) control Fig. 7 with image from Xia et al., 2020
blood vessel EGFP expression increased amount, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) control Fig. 7 with image from Xia et al., 2020
angiogenesis increased process quality, abnormal pku6Tg; y1Tg + MO1-ube3d (TU) control Fig. 7 with image from Xia et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.