Morpholino

MO2-rac2

ID

ZDB-MRPHLNO-201217-3

Name

MO2-rac2

Previous Names

None

Target

rac2 (1)

Sequence

5' - GTAACTTTTCACTCACCCATCTCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rac2

No data available

Phenotype

Phenotype resulting from MO2-rac2

No data available

Phenotype of all Fish created by or utilizing MO2-rac2

Phenotype	Fish	Conditions	Figures
leukocyte migration disrupted, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
thymus primordium leukocyte coro1a expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
thymus lcp1 expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell myb expression increased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
thymus leukocyte coro1a expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
thymus T cell lck expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 2 from Lu et al., 2020
thymus T cell rag1 expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell ccr9a expression increased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue leukocyte lcp1 expression increased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
thymus T cell ccr9a expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 2 from Lu et al., 2020
thymus T cell ccr9b expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 2 from Lu et al., 2020
thymus leukocyte lcp1 expression decreased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
pro-T cell cell migration disrupted, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell mislocalised, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue leukocyte coro1a expression increased amount, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue leukocyte mislocalised, abnormal	WT + MO1-rac2 + MO2-rac2	standard conditions	Fig. 4 from Lu et al., 2020
thymus T cell decreased amount, abnormal	hkz04tTg + MO1-rac2 + MO2-rac2	standard conditions	Fig. 2 from Lu et al., 2020
thymus T cell decreased amount, abnormal	zf411Tg + MO1-rac2 + MO2-rac2	standard conditions	Fig. 2 from Lu et al., 2020

Citations