Morpholino

MO2-top2b

ID

ZDB-MRPHLNO-200916-1

Name

MO2-top2b

Previous Names

None

Target

Sequence

5' - AACGATCAGAAACTGTCCATATGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-top2b

Expressed Gene	Anatomy	Figures
akt1s1	whole organism	Fig. 5 from Xia et al., 2019
top2b	whole organism	Fig. 5 from Xia et al., 2019

Phenotype

Phenotype resulting from MO2-top2b

Phenotype	Fish	Figures
hair cell stereocilium decreased amount, abnormal	AB + MO2-top2b	Fig. 3 from Xia et al., 2019
hair cell stereocilium decreased length, abnormal	AB + MO2-top2b	Fig. 3 from Xia et al., 2019
hair cell stereocilium decreased thickness, abnormal	AB + MO2-top2b	Fig. 3 from Xia et al., 2019
neuromast decreased amount, abnormal	s356tTg + MO2-top2b	Fig. 3, Fig. 4 from Xia et al., 2019
neuromast decreased size, abnormal	s356tTg + MO2-top2b	Fig. 3 from Xia et al., 2019
neuromast hair cell decreased amount, abnormal	s356tTg + MO2-top2b	Fig. 3, Fig. 4 from Xia et al., 2019
neuromast support cell decreased amount, abnormal	s356tTg + MO2-top2b	Fig. 3, Fig. 4 from Xia et al., 2019
whole organism akt1s1 expression decreased amount, abnormal	AB + MO2-top2b	Fig. 5 from Xia et al., 2019
whole organism top2b expression decreased amount, abnormal	AB + MO2-top2b	Fig. 5 from Xia et al., 2019

Phenotype of all Fish created by or utilizing MO2-top2b

Phenotype	Fish	Conditions	Figures
whole organism top2b expression decreased amount, abnormal	AB + MO2-top2b	standard conditions	Fig. 5 from Xia et al., 2019
hair cell stereocilium decreased amount, abnormal	AB + MO2-top2b	standard conditions	Fig. 3 from Xia et al., 2019
hair cell stereocilium decreased length, abnormal	AB + MO2-top2b	standard conditions	Fig. 3 from Xia et al., 2019
hair cell stereocilium decreased thickness, abnormal	AB + MO2-top2b	standard conditions	Fig. 3 from Xia et al., 2019
whole organism akt1s1 expression decreased amount, abnormal	AB + MO2-top2b	standard conditions	Fig. 5 from Xia et al., 2019
neuromast decreased size, abnormal	s356tTg + MO2-top2b	standard conditions	Fig. 3 from Xia et al., 2019
neuromast support cell decreased amount, abnormal	s356tTg + MO2-top2b	standard conditions	Fig. 3, Fig. 4 from Xia et al., 2019
neuromast decreased amount, abnormal	s356tTg + MO2-top2b	standard conditions	Fig. 3, Fig. 4 from Xia et al., 2019
neuromast hair cell decreased amount, abnormal	s356tTg + MO2-top2b	standard conditions	Fig. 3, Fig. 4 from Xia et al., 2019

Citations