Morpholino
MO2-f2rl1.2
- ID
- ZDB-MRPHLNO-200618-1
- Name
- MO2-f2rl1.2
- Previous Names
- None
- Target
- Sequence
-
5' - GTAGCTCTCGGACACCGCCATATTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-f2rl1.2
No data available
Phenotype
Phenotype resulting from MO2-f2rl1.2
No data available
Phenotype of all Fish created by or utilizing MO2-f2rl1.2
1 - 5 of 6 Show all
Citations
- Hatzold, J., Nett, V., Brantsch, S., Zhang, J.L., Armistead, J., Wessendorf, H., Stephens, R., Humbert, P.O., Iden, S., Hammerschmidt, M. (2023) Matriptase-dependent epidermal pre-neoplasm in zebrafish embryos caused by a combination of hypotonic stress and epithelial polarity defects. PLoS Genetics. 19:e1010873e1010873
- Hatzold, J., Wessendorf, H., Pogoda, H.M., Bloch, W., Hammerschmidt, M. (2021) The Kunitz-type serine protease inhibitor Spint2 is required for cellular cohesion, coordinated cell migration and cell survival during zebrafish hatching gland development. Developmental Biology. 476:148-170
- Armistead, J., Hatzold, J., van Roye, A., Fahle, E., Hammerschmidt, M. (2020) Entosis and apical cell extrusion constitute a tumor-suppressive mechanism downstream of Matriptase. The Journal of cell biology. 219(2):
1 - 3 of 3
Show