Morpholino

MO1-bsx

ID
ZDB-MRPHLNO-200408-2
Name
MO1-bsx
Previous Names
None
Target
Sequence
5' - ATTTAACGCAATTACCTGTGTTTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bsx
Expressed Gene Anatomy Figures
bsx Fig. 3 with image from Mano et al., 2019
exorh Fig. 3 with image,  Fig. S4,  Fig. S5 from Mano et al., 2019
noto Fig. S5 from Mano et al., 2019
otx5 Fig. 3 with image from Mano et al., 2019
pax6b Fig. 3 with image from Mano et al., 2019
rho Fig. 3 with image,  Fig. S4,  Fig. S5 from Mano et al., 2019
Phenotype
Phenotype resulting from MO1-bsx
Phenotype Fish Figures
epiphysis exorh expression decreased amount, abnormal WT + MO1-bsx Fig. 3 with image,  Fig. S4 from Mano et al., 2019
epiphysis otx5 expression decreased amount, abnormal WT + MO1-bsx Fig. 3 with image from Mano et al., 2019
epiphysis pax6b expression decreased amount, abnormal WT + MO1-bsx Fig. 3 with image from Mano et al., 2019
epiphysis decreased area, abnormal WT + MO1-bsx Fig. 2 with image from Mano et al., 2019
epiphysis decreased size, abnormal ja1Tg + MO1-bsx Fig. 2 with image,  Fig. S3 from Mano et al., 2019
epiphysis rho expression increased amount, abnormal WT + MO1-bsx Fig. 3 with image,  Fig. S4 from Mano et al., 2019
epiphysis EGFP expression increased amount, abnormal ja2Tg + MO1-bsx Fig. 2 with image from Mano et al., 2019
epiphysis melanocyte increased amount, abnormal ja1Tg + MO1-bsx Fig. S3 from Mano et al., 2019
epiphysis pigment cell present, abnormal ja1Tg + MO1-bsx Fig. S3 from Mano et al., 2019
head exorh expression decreased amount, abnormal WT + MO1-bsx Fig. S5 from Mano et al., 2019
head noto expression decreased amount, abnormal WT + MO1-bsx Fig. S5 from Mano et al., 2019
head rho expression increased amount, abnormal WT + MO1-bsx Fig. S5 from Mano et al., 2019
Phenotype of all Fish created by or utilizing MO1-bsx
Phenotype Fish Conditions Figures
head noto expression decreased amount, abnormal WT + MO1-bsx standard conditions Fig. S5 from Mano et al., 2019
head rho expression increased amount, abnormal WT + MO1-bsx standard conditions Fig. S5 from Mano et al., 2019
epiphysis decreased area, abnormal WT + MO1-bsx standard conditions Fig. 2 with image from Mano et al., 2019
epiphysis exorh expression decreased amount, abnormal WT + MO1-bsx standard conditions Fig. 3 with image,  Fig. S4 from Mano et al., 2019
epiphysis decreased size, abnormal WT + MO1-bsx standard conditions Fig. 2 with image from Mano et al., 2019
epiphysis pax6b expression decreased amount, abnormal WT + MO1-bsx control Fig. 3 with image from Mano et al., 2019
head exorh expression decreased amount, abnormal WT + MO1-bsx standard conditions Fig. S5 from Mano et al., 2019
epiphysis rho expression increased amount, abnormal WT + MO1-bsx standard conditions Fig. 3 with image,  Fig. S4 from Mano et al., 2019
epiphysis otx5 expression decreased amount, abnormal WT + MO1-bsx standard conditions Fig. 3 with image from Mano et al., 2019
epiphysis melanocyte increased amount, abnormal ja1Tg + MO1-bsx standard conditions Fig. S3 from Mano et al., 2019
epiphysis decreased size, abnormal ja1Tg + MO1-bsx standard conditions Fig. S3 from Mano et al., 2019
epiphysis pigment cell present, abnormal ja1Tg + MO1-bsx standard conditions Fig. S3 from Mano et al., 2019
epiphysis EGFP expression increased amount, abnormal ja2Tg + MO1-bsx standard conditions Fig. 2 with image from Mano et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.