Morpholino

MO3-pou5f3

ID
ZDB-MRPHLNO-200330-1
Name
MO3-pou5f3
Previous Names
None
Target
Sequence
5' - CTTTCCGCTAAAAAGGTTGTTGAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-pou5f3
No data available
Phenotype
Phenotype resulting from MO3-pou5f3
No data available
Phenotype of all Fish created by or utilizing MO3-pou5f3
Phenotype Fish Conditions Figures
retina regenerating tissue pou5f3 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue mir200a expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue dla expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue ccnb1 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue dla expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue chd4b expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 7. with image from Sharma et al., 2019
retina regenerating tissue zeb2a expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue ccnb1 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue mir200b expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue tgfbr1b expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue Ab16-sox2 labeling increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue snai1b expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue snai1b expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue tgfb1a expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue lepa expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue tgfbr1b expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue cdh1 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue mir145 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue ascl1a expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue ccnd1 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue chd3 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 7. with image from Sharma et al., 2019
retina regenerating tissue il11b expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue sox2 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue zeb1b expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue her4.1 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image from Sharma et al., 2019
retina regenerating tissue snai2 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue ccna1 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue lepr expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue tgfbi expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue dlc expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue il11a expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue mycb expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue chd4a expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 7. with image from Sharma et al., 2019
retina regenerating tissue hdac1 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 7. with image from Sharma et al., 2019
retina regenerating tissue zeb1a expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue snai3 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue ccne1 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue dld expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue lin28ab expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image,  Figure 6. with image from Sharma et al., 2019
retina regenerating tissue zeb2b expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue mmp2 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue snai1a expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue dlb expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue dlb expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue snai1a expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
Muller cell cell population proliferation decreased occurrence, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image from Sharma et al., 2019
retina regenerating tissue tgfb1b expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue lepb expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue smad7 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue tgfb3 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue ccnd1 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue tgfb2 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue ascl1a expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image from Sharma et al., 2019
retina regenerating tissue Ab16-sox2 labeling decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image from Sharma et al., 2019
Muller cell cell population proliferation increased occurrence, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image,  Figure 7. with image from Sharma et al., 2019
retina regenerating tissue sox2 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image from Sharma et al., 2019
retina regenerating tissue snai3 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue tgfbi expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 6. with image from Sharma et al., 2019
retina regenerating tissue ab4-pou5f3 labeling decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image,  Figure 6. with image from Sharma et al., 2019
retina regenerating tissue dlc expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue ccna1 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S5. with image from Sharma et al., 2019
retina regenerating tissue pou5f3 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure 2. with image from Sharma et al., 2019
retina regenerating tissue snai2 expression increased amount, abnormal WT + MO3-pou5f3 perforation: retina Fig. 3 from Sharma et al., 2019
retina regenerating tissue ccne1 expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
retina regenerating tissue dld expression decreased amount, abnormal WT + MO3-pou5f3 perforation: retina Figure S3. with image from Sharma et al., 2019
Muller cell cell population proliferation decreased occurrence, exacerbated WT + MO3-cdh1 + MO3-pou5f3 perforation: retina Figure 4. with image from Sharma et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.