Morpholino

MO5-ntn1a

ID

ZDB-MRPHLNO-190807-1

Name

MO5-ntn1a

Previous Names

None

Target

ntn1a (1)

Sequence

5' - CATCAGAGACTCTCAACATCCTCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-ntn1a

No data available

Phenotype

Phenotype resulting from MO5-ntn1a

Phenotype	Fish	Figures
closure of optic fissure decreased occurrence, abnormal	WT + MO5-ntn1a	Figure 4 - figure supplement 3 from Hardy et al., 2019 Fig. 7 from Richardson et al., 2019
eye atoh7 expression decreased amount, abnormal	AB + MO5-ntn1a	Fig. 8 from Richardson et al., 2019
eye decreased size, abnormal	WT + MO5-ntn1a	Figure 4 - figure supplement 3 from Hardy et al., 2019
macula stereocilium bundle decreased amount, abnormal	AB + MO5-ntn1a	FIGURE 2 from Toms et al., 2024
neuromast hair cell cell body absence of anatomical entity, abnormal	AB + MO5-ntn1a	FIGURE 2 from Toms et al., 2024
neuromast hair cell kinocilium absence of anatomical entity, abnormal	AB + MO5-ntn1a	FIGURE 2 from Toms et al., 2024
neuromast hair cell stereocilium bundle absence of anatomical entity, abnormal	AB + MO5-ntn1a	FIGURE 2 from Toms et al., 2024
neuromast hair cell stereocilium bundle decreased amount, abnormal	AB + MO5-ntn1a	FIGURE 2 from Toms et al., 2024
optic fissure closure incomplete, abnormal	AB + MO5-ntn1a	FIGURE 2 from Toms et al., 2024 Figure 4 - figure supplement 3 from Hardy et al., 2019 Fig. 7 from Richardson et al., 2019
optic fissure morphology, abnormal	AB + MO5-ntn1a	Fig. 7 from Richardson et al., 2019
optic fissure open, abnormal	AB + MO5-ntn1a	Figure 4 - figure supplement 3 from Hardy et al., 2019 Fig. 7 from Richardson et al., 2019

Phenotype of all Fish created by or utilizing MO5-ntn1a

Phenotype	Fish	Conditions	Figures
macula stereocilium bundle decreased amount, abnormal	AB + MO5-ntn1a	control	FIGURE 2 from Toms et al., 2024
neuromast hair cell kinocilium absence of anatomical entity, abnormal	AB + MO5-ntn1a	control	FIGURE 2 from Toms et al., 2024
optic fissure closure incomplete, abnormal	AB + MO5-ntn1a	control	FIGURE 2 from Toms et al., 2024 Fig. 7 from Richardson et al., 2019
optic fissure open, abnormal	AB + MO5-ntn1a	standard conditions	Fig. 7 from Richardson et al., 2019
eye atoh7 expression decreased amount, abnormal	AB + MO5-ntn1a	standard conditions	Fig. 8 from Richardson et al., 2019
neuromast hair cell stereocilium bundle decreased amount, abnormal	AB + MO5-ntn1a	control	FIGURE 2 from Toms et al., 2024
neuromast hair cell stereocilium bundle absence of anatomical entity, abnormal	AB + MO5-ntn1a	control	FIGURE 2 from Toms et al., 2024
neuromast hair cell cell body absence of anatomical entity, abnormal	AB + MO5-ntn1a	control	FIGURE 2 from Toms et al., 2024
optic fissure morphology, abnormal	AB + MO5-ntn1a	standard conditions	Fig. 7 from Richardson et al., 2019
closure of optic fissure decreased occurrence, abnormal	AB + MO5-ntn1a	standard conditions	Fig. 7 from Richardson et al., 2019
closure of optic fissure decreased occurrence, abnormal	WT + MO5-ntn1a	standard conditions	Figure 4 - figure supplement 3 from Hardy et al., 2019
eye decreased size, abnormal	WT + MO5-ntn1a	standard conditions	Figure 4 - figure supplement 3 from Hardy et al., 2019
optic fissure closure incomplete, abnormal	WT + MO5-ntn1a	standard conditions	Figure 4 - figure supplement 3 from Hardy et al., 2019
optic fissure open, abnormal	WT + MO5-ntn1a	standard conditions	Figure 4 - figure supplement 3 from Hardy et al., 2019

Citations