Morpholino

MO5-ntn1a

ID
ZDB-MRPHLNO-190807-1
Name
MO5-ntn1a
Previous Names
None
Target
Sequence
5' - CATCAGAGACTCTCAACATCCTCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-ntn1a
No data available
Phenotype
Phenotype resulting from MO5-ntn1a
Phenotype of all Fish created by or utilizing MO5-ntn1a
Phenotype Fish Conditions Figures
macula stereocilium bundle decreased amount, abnormal AB + MO5-ntn1a control FIGURE 2 with image from Toms et al., 2024
neuromast hair cell kinocilium absence of anatomical entity, abnormal AB + MO5-ntn1a control FIGURE 2 with image from Toms et al., 2024
optic fissure closure incomplete, abnormal AB + MO5-ntn1a control FIGURE 2 with image from Toms et al., 2024
Fig. 7 with image from Richardson et al., 2019
optic fissure open, abnormal AB + MO5-ntn1a standard conditions Fig. 7 with image from Richardson et al., 2019
eye atoh7 expression decreased amount, abnormal AB + MO5-ntn1a standard conditions Fig. 8 with image from Richardson et al., 2019
neuromast hair cell stereocilium bundle decreased amount, abnormal AB + MO5-ntn1a control FIGURE 2 with image from Toms et al., 2024
neuromast hair cell stereocilium bundle absence of anatomical entity, abnormal AB + MO5-ntn1a control FIGURE 2 with image from Toms et al., 2024
neuromast hair cell cell body absence of anatomical entity, abnormal AB + MO5-ntn1a control FIGURE 2 with image from Toms et al., 2024
optic fissure morphology, abnormal AB + MO5-ntn1a standard conditions Fig. 7 with image from Richardson et al., 2019
closure of optic fissure decreased occurrence, abnormal AB + MO5-ntn1a standard conditions Fig. 7 with image from Richardson et al., 2019
closure of optic fissure decreased occurrence, abnormal WT + MO5-ntn1a standard conditions Figure 4 - figure supplement 3 with image from Hardy et al., 2019
eye decreased size, abnormal WT + MO5-ntn1a standard conditions Figure 4 - figure supplement 3 with image from Hardy et al., 2019
optic fissure closure incomplete, abnormal WT + MO5-ntn1a standard conditions Figure 4 - figure supplement 3 with image from Hardy et al., 2019
optic fissure open, abnormal WT + MO5-ntn1a standard conditions Figure 4 - figure supplement 3 with image from Hardy et al., 2019
optic stalk increased volume, abnormal ptch2tc294z/tc294z; z200Tg + MO5-ntn1a (TL, TU) control Fig. 4 with image from Lusk et al., 2024
optic fissure increased angle to optic fissure, abnormal ptch2tc294z/tc294z; z200Tg + MO5-ntn1a (TL, TU) control Fig. 4 with image from Lusk et al., 2024
Citations