Morpholino
MO1-bcl11ba
- ID
- ZDB-MRPHLNO-190711-5
- Name
- MO1-bcl11ba
- Previous Names
- None
- Target
- Sequence
-
5' - TTCCCTGCTTGCGACGGGACATTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bcl11ba
No data available
Phenotype
Phenotype resulting from MO1-bcl11ba
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-bcl11ba
1 - 5 of 15 Show all
Citations
- Lu, H.Y., Sertori, R., Contreras, A.V., Hamer, M., Messing, M., Del Bel, K.L., Lopez-Rangel, E., Chan, E.S., Rehmus, W., Milner, J.D., McNagny, K.M., Lehman, A., Wiest, D.L., Turvey, S.E. (2021) A Novel Germline Heterozygous BCL11B Variant Causing Severe Atopic Disease and Immune Dysregulation. Frontiers in immunology. 12:788278
- Punwani, D., Zhang, Y., Yu, J., Cowan, M.J., Rana, S., Kwan, A., Adhikari, A.N., Lizama, C.O., Mendelsohn, B.A., Fahl, S.P., Chellappan, A., Srinivasan, R., Brenner, S.E., Wiest, D.L., Puck, J.M. (2016) Multisystem Anomalies in Severe Combined Immunodeficiency with Mutant BCL11B. The New England Journal of Medicine. 375:2165-2176
1 - 2 of 2
Show