Morpholino

MO6-ptk2ab

ID

ZDB-MRPHLNO-190312-3

Name

MO6-ptk2ab

Previous Names

fak1atMO1 (1)

Target

ptk2ab (1)

Sequence

5' - GTGGGTGCTAACTGTCCGTCATATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-ptk2ab

Expressed Gene	Anatomy	Figures
cdc42	whole organism	Figure 9. from Hung et al., 2020
ctslb	prechordal plate	Figure 4. , Figure 8. from Hung et al., 2020
dlx3b	ectoderm	Figure 4. , Figure 8. from Hung et al., 2020
myod1	somite	Figure 4. from Hung et al., 2020
rac1l	whole organism	Figure 9. from Hung et al., 2020
tbxta	notochord	Figure 4. , Figure 8. from Hung et al., 2020
wnt5b	whole organism	Figure 7. from Hung et al., 2020

Phenotype

Phenotype resulting from MO6-ptk2ab

Phenotype	Fish	Figures
blastoderm anatomical margin morphology, abnormal	WT + MO6-ptk2ab	Figure 3. from Hung et al., 2020
convergent extension spatial distribution of a process, abnormal	WT + MO6-ptk2ab	Figure 4. , Figure 8. , Figure 9. from Hung et al., 2020
epiboly arrested, abnormal	WT + MO6-ptk2ab	Figure 2. from Hung et al., 2020
epiboly delayed, abnormal	WT + MO6-ptk2ab	Figure 2. from Hung et al., 2020
epiboly disrupted, abnormal	WT + MO6-ptk2ab	Figure 3. from Hung et al., 2020
EVL cell migration asynchronous, abnormal	WT + MO6-ptk2ab	Figure 3. from Hung et al., 2020
hypoblast cell migration decreased linear velocity, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
hypoblast cell migration decreased rate, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
hypoblast cell migration disrupted, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
hypoblast cell migration process quality, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
margin actin filament bundle decreased amount, abnormal	WT + MO6-ptk2ab	Figure 3. , Figure 9. from Hung et al., 2020
prechordal plate cell migration decreased linear velocity, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
prechordal plate cell migration disrupted, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
prechordal plate cell migration process quality, abnormal	WT + MO6-ptk2ab	Figure 5. from Hung et al., 2020
somite increased width, abnormal	WT + MO6-ptk2ab	Figure 4. from Hung et al., 2020
tail bud hypoplastic, abnormal	WT + MO6-ptk2ab	Figure 4. from Hung et al., 2020
whole organism rac1l expression decreased amount, abnormal	WT + MO6-ptk2ab	Figure 9. from Hung et al., 2020
whole organism axis decreased length, abnormal	WT + MO6-ptk2ab	Figure 4. from Hung et al., 2020
yolk syncytial layer nucleus spatial pattern, abnormal	WT + MO6-ptk2ab	Figure 3. from Hung et al., 2020

Phenotype of all Fish created by or utilizing MO6-ptk2ab

Phenotype	Fish	Conditions	Figures
epiboly delayed, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 2. from Hung et al., 2020
prechordal plate cell migration process quality, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020
margin actin filament bundle decreased amount, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 3. , Figure 9. from Hung et al., 2020
prechordal plate cell migration decreased linear velocity, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020
convergent extension spatial distribution of a process, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 4. , Figure 8. , Figure 9. from Hung et al., 2020
epiboly disrupted, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 3. from Hung et al., 2020
hypoblast cell migration disrupted, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020
somite increased width, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 4. from Hung et al., 2020
hypoblast cell migration decreased linear velocity, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020
hypoblast cell migration process quality, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020
prechordal plate cell migration disrupted, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020
epiboly arrested, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 2. from Hung et al., 2020
whole organism rac1l expression decreased amount, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 9. from Hung et al., 2020
tail bud hypoplastic, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 4. from Hung et al., 2020
EVL cell migration asynchronous, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 3. from Hung et al., 2020
yolk syncytial layer nucleus spatial pattern, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 3. from Hung et al., 2020
whole organism axis decreased length, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 4. from Hung et al., 2020
blastoderm anatomical margin morphology, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 3. from Hung et al., 2020
hypoblast cell migration decreased rate, abnormal	WT + MO6-ptk2ab	standard conditions	Figure 5. from Hung et al., 2020

Citations