Morpholino
MO6-ptk2ab
- ID
- ZDB-MRPHLNO-190312-3
- Name
- MO6-ptk2ab
- Previous Names
-
- fak1atMO1 (1)
- Target
- Sequence
-
5' - GTGGGTGCTAACTGTCCGTCATATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-ptk2ab
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| cdc42 |
Figure 9. 
from Hung et al., 2020 |
|
| ctslb |
Figure 4. ,
Figure 8.
from Hung et al., 2020 |
|
| dlx3b |
Figure 4. ,
Figure 8.
from Hung et al., 2020 |
|
| myod1 |
Figure 4.
from Hung et al., 2020 |
|
| rac1l |
Figure 9.
from Hung et al., 2020 |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO6-ptk2ab
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO6-ptk2ab
1 - 5 of 19 Show all
Citations
- Hung, I.C., Chen, T.M., Lin, J.P., Tai, Y.L., Shen, T.L., Lee, S.J. (2020) Wnt5b integrates Fak1a to mediate gastrulation cell movements via Rac1 and Cdc42. Open Biology. 10:190273
- Gutzman, J.H., Graeden, E., Brachmann, I., Yamazoe, S., Chen, J.K., Sive, H. (2018) Basal constriction during midbrain-hindbrain boundary morphogenesis is mediated by Wnt5b and focal adhesion kinase. Biology Open. 7(11):
1 - 2 of 2
Show