Morpholino

MO1-rnf152

ID
ZDB-MRPHLNO-180522-1
Name
MO1-rnf152
Previous Names
None
Target
Sequence
5' - GCTCTGGGACAAGCTATCCATCGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rnf152
Expressed Gene Anatomy Figures
ascl1a Fig. 7 with image from Kumar et al., 2017
dlc Fig. S2 with image from Kumar et al., 2017
dld Fig. 5 with image from Kumar et al., 2017
her4.1 Fig. 7 with image from Kumar et al., 2017
neurod1 Fig. 4 with image from Kumar et al., 2017
notch1a Fig. 6 with image from Kumar et al., 2017
notch1b Fig. S3 with image from Kumar et al., 2017
notch3 Fig. 6 with image from Kumar et al., 2017
pax6a Fig. 4 with image from Kumar et al., 2017
rx2 Fig. S4 with image from Kumar et al., 2017
Phenotype
Phenotype resulting from MO1-rnf152
Phenotype Fish Figures
brain dlc expression decreased amount, abnormal WT + MO1-rnf152 Fig. S2 with image from Kumar et al., 2017
diencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
eye ascl1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
eye her4.1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
eye neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
eye notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
eye dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
eye decreased diameter, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
eye decreased size, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
forebrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
forebrain dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
hindbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
hindbrain dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
hindbrain her4.1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
hindbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
midbrain dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
midbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
midbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
midbrain ascl1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
midbrain hindbrain boundary dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
midbrain hindbrain boundary her4.1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
neural tube decreased width, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
pancreatic bud neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
posterior lateral line ganglion neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
presumptive neural retina neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
presumptive neural retina dlc expression increased amount, abnormal WT + MO1-rnf152 Fig. S2 with image from Kumar et al., 2017
rhombomere decreased size, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
telencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
Phenotype of all Fish created by or utilizing MO1-rnf152
Phenotype Fish Conditions Figures
midbrain dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
forebrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
midbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
pancreatic bud neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
forebrain dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
midbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
telencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
brain dlc expression decreased amount, abnormal WT + MO1-rnf152 control Fig. S2 with image from Kumar et al., 2017
neural tube decreased width, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
eye decreased size, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
hindbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
presumptive neural retina dlc expression increased amount, abnormal WT + MO1-rnf152 control Fig. S2 with image from Kumar et al., 2017
eye her4.1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
eye dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
midbrain ascl1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
midbrain hindbrain boundary dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
posterior lateral line ganglion neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
hindbrain dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
rhombomere decreased size, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
hindbrain her4.1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
eye decreased diameter, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
eye ascl1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
midbrain hindbrain boundary her4.1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
eye notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
presumptive neural retina neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
diencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
eye neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
hindbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.