Morpholino

MO3-fer

ID
ZDB-MRPHLNO-180427-1
Name
MO3-fer
Previous Names
None
Target
Sequence
5' - CTGGAAGAGAGACAGAGATCACACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fer
No data available
Phenotype
Phenotype resulting from MO3-fer
Phenotype Fish Figures
blood circulation decreased occurrence, abnormal y7Tg + MO3-fer Fig. 3 with imageFig. 4 with imageFig. 5 with image from Dunn et al., 2017
blood island gata1a expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island myb expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island tal1 expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island runx1 expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island hbbe2 expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
circulating cell decreased amount, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
convergent extension process quality, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
dorsal aorta decreased diameter, abnormal y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
dorsal aorta anatomical region disorganized, abnormal y7Tg + MO3-fer Fig. 4 with imageFig. 5 with image from Dunn et al., 2017
dorsal aorta sprouting angiogenesis decreased occurrence, abnormal y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
endothelial cell decreased amount, abnormal sd2Tg; y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
heart nucleate erythrocyte absent, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
hematopoietic cell increased amount, abnormal sd2Tg; y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
hematopoietic cell blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer Fig. 4 with image from Dunn et al., 2017
intersegmental vessel malformed, abnormal sd2Tg; y7Tg + MO3-fer Fig. 4 with image from Dunn et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
lateral plate mesoderm tal1 expression spatial pattern, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
lateral plate mesoderm gata1a expression spatial pattern, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
nucleate erythrocyte increased accumulation intermediate cell mass of mesoderm posterior region, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
pericardium edematous, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
posterior cardinal vein anatomical region disorganized, abnormal sd2Tg; y7Tg + MO3-fer Fig. 4 with image from Dunn et al., 2017
posterior lateral plate mesoderm runx1 expression decreased amount, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
trunk notch1b expression increased amount, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
trunk nucleate erythrocyte increased amount, abnormal AB + MO3-fer Fig. 3 with image from Dunn et al., 2017
whole organism notch1b expression decreased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism notch1a expression decreased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism runx1 expression decreased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism myb expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism hbbe2 expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism tal1 expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism notch1b expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism notch1a expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism gata1a expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism anterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer Fig. 3 with image from Dunn et al., 2017
whole organism posterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer Fig. 3 with image from Dunn et al., 2017
Phenotype of all Fish created by or utilizing MO3-fer
Phenotype Fish Conditions Figures
whole organism notch1a expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
circulating cell decreased amount, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
lateral plate mesoderm gata1a expression spatial pattern, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
whole organism runx1 expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism tal1 expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood island runx1 expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
lateral plate mesoderm tal1 expression spatial pattern, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
blood island hbbe2 expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
whole organism notch1b expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism hbbe2 expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood island tal1 expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
trunk notch1b expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
nucleate erythrocyte increased accumulation intermediate cell mass of mesoderm posterior region, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
whole organism notch1b expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism myb expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
heart nucleate erythrocyte absent, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
whole organism posterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
pericardium edematous, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
whole organism anterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
whole organism gata1a expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism notch1a expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood circulation decreased occurrence, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
convergent extension process quality, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
posterior lateral plate mesoderm runx1 expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
blood island myb expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
blood island gata1a expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
trunk nucleate erythrocyte increased amount, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
dorsal aorta decreased diameter, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
dorsal aorta sprouting angiogenesis decreased occurrence, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
blood circulation decreased occurrence, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
dorsal aorta anatomical region disorganized, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
posterior cardinal vein anatomical region disorganized, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
hematopoietic cell blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
endothelial cell decreased amount, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
hematopoietic cell increased amount, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
intersegmental vessel malformed, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with imageFig. 5 with image from Dunn et al., 2017
dorsal aorta anatomical region disorganized, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
Citations