header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-180426-2
Morpholino Name: MO1-wnt10a
Target: wnt10a (1)
Sequence:
5' - GTCGTGAGAGCTCATTCATGGAATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wnt10a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wnt10a
Expressed Gene Anatomy Figures
axin2 Fig. 4 with image from Yuan et al., 2017
dlx2b Fig. 4 with image from Yuan et al., 2017
eda Fig. 4 with image from Yuan et al., 2017
msx1a Fig. 4 with image from Yuan et al., 2017
wnt10a Fig. 3 with image from Yuan et al., 2017
PHENOTYPE
Phenotype resulting from MO1-wnt10a
Phenotype of all Fish created by or utilizing MO1-wnt10a
Genome Resources:
CITATIONS (1)