Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-kif20a

ID
ZDB-MRPHLNO-180305-8
Name
MO1-kif20a
Previous Names
None
Target
Sequence
5' - GCATGGAGACGCCAGAGCCATTATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kif20a
Expressed Gene Anatomy Figures
kif20a Fig. 5 with image from Louw et al., 2018
Phenotype
Phenotype resulting from MO1-kif20a
Phenotype of all Fish created by or utilizing MO1-kif20a
Phenotype Fish Conditions Figures
heart decreased size, abnormal WT + MO1-kif20a standard conditions Fig. 6 with image from Louw et al., 2018
cardiac ventricle increased thickness, abnormal WT + MO1-kif20a standard conditions Fig. 6 with image from Louw et al., 2018
blood accumulation atrium, abnormal WT + MO1-kif20a standard conditions Fig. 6 with image from Louw et al., 2018
trunk decreased length, abnormal WT + MO1-kif20a standard conditions text only from Louw et al., 2018
atrium increased thickness, abnormal WT + MO1-kif20a standard conditions Fig. 6 with image from Louw et al., 2018
whole organism decreased length, abnormal WT + MO1-kif20a standard conditions text only from Louw et al., 2018
heart contraction increased rate, abnormal WT + MO1-kif20a standard conditions Fig. 6 with image from Louw et al., 2018
pericardium edematous, abnormal WT + MO1-kif20a standard conditions Fig. 6 with imageFig. S5 with imagetext only from Louw et al., 2018
bulbus arteriosus decreased size, abnormal WT + MO1-kif20a standard conditions Fig. 6 with image from Louw et al., 2018
brain edematous, abnormal WT + MO1-kif20a standard conditions text only from Louw et al., 2018
whole organism kif20a expression decreased amount, abnormal WT + MO1-kif20a standard conditions Fig. 5 with image from Louw et al., 2018
heart decreased functionality, abnormal WT + MO1-kif20a standard conditions Fig. 6 with imagetext only from Louw et al., 2018
pericardium edematous, abnormal WT + MO1-kif20a + MO4-tp53 standard conditions text only from Louw et al., 2018
heart decreased functionality, abnormal WT + MO1-kif20a + MO4-tp53 standard conditions text only from Louw et al., 2018
pericardium edematous, abnormal s843Tg + MO1-kif20a standard conditions Fig. 5 with image from Louw et al., 2018
brain edematous, abnormal s843Tg + MO1-kif20a standard conditions Fig. 5 with image from Louw et al., 2018
Citations