Morpholino

MO1-mpc1

ID
ZDB-MRPHLNO-180130-8
Name
MO1-mpc1
Previous Names
None
Target
Sequence
5' - TCAGAGCTGTGGACACACCAGAGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mpc1
No data available
Phenotype
Phenotype resulting from MO1-mpc1
Phenotype Fish Figures
aerobic respiration decreased rate, abnormal TU + MO1-mpc1 Fig. 4 with image from Sandoval et al., 2017
brain ascl1a expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
digestive tract development process quality, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
exocrine pancreas prss1 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
exocrine pancreas development decreased occurrence, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
eye decreased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
gut fabp2 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
gut has fewer parts of type cell, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
head decreased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
heart looping decreased occurrence, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
hindbrain increased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
intestine shape, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
intestine surface feature shape, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
lens decreased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
mandibular arch skeleton cartilage development decreased occurrence, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
pectoral fin absent, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
pectoral fin bud id1 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
pericardium edematous, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
retinal neural layer malformed, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
retinal photoreceptor layer rbp3 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
retinal pigmented epithelium rbp3 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
whole organism curved, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
whole organism mpc2b expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism slc16a1b expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pdha1a expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pdk1 expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism cs expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pkma expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism ldha expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pcxb expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism slc16a3b expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism triglyceride decreased amount, abnormal TU + MO1-mpc1 Fig. 4 with image from Sandoval et al., 2017
Phenotype of all Fish created by or utilizing MO1-mpc1
Phenotype Fish Conditions Figures
whole organism slc16a1b expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
whole organism pcxb expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
retinal pigmented epithelium rbp3 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism cs expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
exocrine pancreas development decreased occurrence, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
pectoral fin bud id1 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
exocrine pancreas prss1 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
aerobic respiration decreased rate, abnormal TU + MO1-mpc1 standard conditions Fig. 4 with image from Sandoval et al., 2017
intestine surface feature shape, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism mpc2b expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
gut has fewer parts of type cell, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
mandibular arch skeleton cartilage development decreased occurrence, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
retinal photoreceptor layer rbp3 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
pectoral fin absent, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
retinal neural layer malformed, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
lens decreased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
brain ascl1a expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
digestive tract development process quality, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism pdk1 expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
heart looping decreased occurrence, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism curved, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
eye decreased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
gut fabp2 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism triglyceride decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 with image from Sandoval et al., 2017
head decreased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism pdha1a expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
whole organism pkma expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
hindbrain increased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
pericardium edematous, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism ldha expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
intestine shape, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism slc16a3b expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
Citations