Morpholino
MO2-sting1
- ID
- ZDB-MRPHLNO-171025-2
- Name
- MO2-sting1
- Previous Names
-
- MO2-tmem173
- exon 2 intron 2 (1)
- Target
- Sequence
-
5' - TGGAATGGGATCAATCTTACCAGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sting1
No data available
Phenotype
Phenotype resulting from MO2-sting1
No data available
Phenotype of all Fish created by or utilizing MO2-sting1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| fourth ventricle monocyte decreased amount, abnormal | AB + MO2-sting1 | bacterial treatment by injection: Mycobacterium marinum |
Fig. 3 |
Citations