Morpholino

MO1-onecutl

ID
ZDB-MRPHLNO-171011-2
Name
MO1-onecutl
Previous Names
  • ocl MO (1)
Target
Sequence
5' - ACATCTCTCCCATATTACCATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-onecutl
No data available
Phenotype
Phenotype resulting from MO1-onecutl
Phenotype Fish Figures
eye decreased size, abnormal AB + MO1-onecutl Figure 3 with image from Vassalli et al., 2024
eye morphology, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecutl Figure 5 with image from Vassalli et al., 2024
whole organism cplx2a expression decreased amount, abnormal AB + MO1-onecutl Figure 7 with image from Vassalli et al., 2024
whole organism prox1a expression increased amount, abnormal AB + MO1-onecutl Figure 7 with image from Vassalli et al., 2024
Phenotype of all Fish created by or utilizing MO1-onecutl
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB + MO1-onecutl standard conditions Figure 3 with image from Vassalli et al., 2024
whole organism prox1a expression increased amount, abnormal AB + MO1-onecutl standard conditions Figure 7 with image from Vassalli et al., 2024
whole organism cplx2a expression decreased amount, abnormal AB + MO1-onecutl standard conditions Figure 7 with image from Vassalli et al., 2024
eye morphology, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecutl standard conditions Figure 5 with image from Vassalli et al., 2024
whole organism tmtc2a expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
eye decreased size, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 3 with image from Vassalli et al., 2024
whole organism cplx2b expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
whole organism diras1a expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
whole organism cplx2a expression decreased amount, abnormal AB + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 7 with image from Vassalli et al., 2024
brain vegfaa expression amount, ameliorated WT + MO1-mir9 + MO1-nr2e1 + MO1-onecutl standard conditions Fig. 3 with image from Madelaine et al., 2017
retinal outer nuclear layer decreased size, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
amacrine cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
eye morphology, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
retinal ganglion cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
horizontal cell decreased amount, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
swimming behavior increased process quality, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 6 with image from Vassalli et al., 2024
photoreceptor cell axon terminus absence of anatomical entity, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 5 with image from Vassalli et al., 2024
swimming behavior increased linear velocity, abnormal cu2Tg; jh1Tg; q20Tg + MO1-onecut2 + MO1-onecutl + MO3-onecut1 standard conditions Figure 6 with image from Vassalli et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.